Rmu_sc0001685.1_g000046

SNF1-related protein kinase regulatory subunit gamma-1-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001685.1
Physical Location & Seq
Reverse (-)
246832 .. 249355
2524 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001685.1_g000046.1.cds

Sequence Viewer

Length: 1467 bp
atggcaaagctagacttgatacatgcagaggcagataactgtttctcggaagagaatggtcagaatttccaaagaacagaacccaaaaccaatctcggaatcaactgcaagcacacacttgaagagtttaatgcacatatggcacaaccacaagaagctaagggaagttctaatatttcaagctatgattcctacttcaagacagtacaggcaaggaagaaattaccacattcgctacaagaggttttaacaactgcatttgcaaaaatcccagtttcctcttttccaggagttcctggaggcaaagtagttgagattccagcagatacatctatcggcgatgcagtcaagattctgtctgaatgcaacattttgtcagctcctgtgagaaacccagctgcagaaaccagctcagaatggagagataggtacctgggaatcatagattactctgccattattctttgggtgttggagagtgcagaactagctgcagttgctctctcagctacttcagcaacagctgcaggagttggtgcaggagctgttggcgcaattggagcagttgcattgggtgtgaccggtcctgctgcagttgcagggttaaccgctgctgcagttggagctgcggtggctggcggagtggctgcggacaaagggatgggcaaagatgctcccacagctgctgatgaattgggccaagacttttacaaaactatactgcaagatgaacccttcaagtcaaccacagtaaggtcaatacttaaatccttccgctgggcacctttccttccagtagcaaccgatagttctatgttgagcgtcttgctactactctcaaaatataggctcaggaatgtacctgtgatagaacctggccaagctactatcaagaactacattactcaatcagcaattgttcatggtcttgagcgatgcaaaggaagggattggtttgactgcattgccgcaaagcctatatctgatctgggacttccttttatgtccactgatgaggttattagtgtcctgagcgatgacttgatactggaagctttcaagaagatgagagataatcaaattggcggtcttccagttgtagaagggacaaagaagcagatagtcggtaatgtcagcataagagatatcagacacttgctgctcaaacccgagctcttctccaatttcaggaagctcactgtcagggacttcatgagcaccatctcgacaagccagaatattggaaaagccgtcccagcaattacatgcaatctcgagtccactcttggcaatgtgattgaaactcttgcttccaagtccgttcatagaatctacgtggcagggcaggaaggtgaagttgttggtgtcattactctcagagatgtgatttcttgcttcatttatgagccccccaaccactttgatgactgcatggggtctgcgttgaaggagatgctgaatgagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

488

Amino Acids

52.21

Weight (kDa)

5.63

Isoelectric Point (pI)

39.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 429
AccB1I GGYRCC 2 cut(s) 429, 781
AciI CCGC 7 cut(s) 609, 629, 639, 650, 775, 969, 1086
AcoI YGGCCR 1 cut(s) 877
AcsI RAATTY 1 cut(s) 64
AcuI CTGAAG 1 cut(s) 498
AfaI GTAC 3 cut(s) 207, 431, 861
AfiI CCNNNNNNNGG 3 cut(s) 753, 777, 1188
AgeI ACCGGT 1 cut(s) 581
AgsI TTSAA 7 cut(s) 122, 180, 199, 739, 1060, 1301, 1447
AjnI CCWGG 4 cut(s) 286, 295, 432, 874
Alw21I GWGCWC 2 cut(s) 1176, 1220
AlwNI CAGNNNCTG 3 cut(s) 383, 545, 686
Ama87I CYCGRG 2 cut(s) 1169, 1274
AoxI GGCC 2 cut(s) 697, 877
ApoI RAATTY 1 cut(s) 64
ArsI GACNNNNNNTTYG 2 cut(s) 1072, 1104
AsiGI ACCGGT 1 cut(s) 581
Asp718I GGTACC 1 cut(s) 429
AspLEI GCGC 1 cut(s) 554
AspS9I GGNCC 2 cut(s) 584, 697
AsuHPI GGTGA 1 cut(s) 1364
AvaI CYCGRG 2 cut(s) 1169, 1274
AvaII GGWCC 1 cut(s) 584
BaeGI GKGCMC 1 cut(s) 784
BalI TGGCCA 1 cut(s) 879
BanI GGYRCC 2 cut(s) 429, 781
BanII GRGCYC 2 cut(s) 1176, 1410
BbsI GAAGAC 1 cut(s) 1082
Bbv12I GWGCWC 2 cut(s) 1176, 1220
BccI CCATC 2 cut(s) 655, 1229
BceAI ACGGC 1 cut(s) 1235
BciT130I CCWGG 4 cut(s) 288, 297, 434, 876
BfaI CTAG 2 cut(s) 11, 488
BfmI CTRYAG 5 cut(s) 399, 492, 525, 591, 615
Bme1390I CCNGG 4 cut(s) 288, 297, 434, 876
Bme18I GGWCC 1 cut(s) 584
BmeT110I CYCGRG 2 cut(s) 1169, 1274
BmgT120I GGNCC 2 cut(s) 584, 697
BmiI GGNNCC 2 cut(s) 431, 783
BmrFI CCNGG 4 cut(s) 288, 297, 434, 876
BmrI ACTGGG 1 cut(s) 266
BmsI GCATC 4 cut(s) 331, 661, 926, 1443
BmuI ACTGGG 1 cut(s) 266
BpiI GAAGAC 1 cut(s) 1082
BplI GAGNNNNNCTC 2 cut(s) 1163, 1195
BpmI CTGGAG 1 cut(s) 318
Bpu10I CCTNAGC 3 cut(s) 159, 851, 1031
BpuEI CTTGAG 1 cut(s) 950
BsaAI YACGTR 1 cut(s) 1336
BsaJI CCNNGG 1 cut(s) 433
BsaWI WCCGGW 1 cut(s) 581
BsaXI ACNNNNNCTCC 4 cut(s) 291, 321, 615, 645
Bsc4I CCNNNNNNNGG 3 cut(s) 753, 777, 1188
Bse118I RCCGGY 1 cut(s) 581
Bse1I ACTGG 4 cut(s) 272, 794, 1053, 1094
Bse3DI GCAATG 2 cut(s) 963, 1297
BseBI CCWGG 4 cut(s) 288, 297, 434, 876
BseDI CCNNGG 1 cut(s) 433
BseGI GGATG 1 cut(s) 666
BseLI CCNNNNNNNGG 3 cut(s) 753, 777, 1188
BseMI GCAATG 2 cut(s) 963, 1297
BseMII CTCAG 5 cut(s) 426, 519, 865, 1022, 1390
BseNI ACTGG 4 cut(s) 272, 794, 1053, 1094
BseSI GKGCMC 1 cut(s) 784
BseYI CCCAGC 3 cut(s) 394, 777, 1255
BsgI GTGCAG 2 cut(s) 501, 558
BshFI GGCC 2 cut(s) 699, 879
BshNI GGYRCC 2 cut(s) 429, 781
BshTI ACCGGT 1 cut(s) 581
BsiHKAI GWGCWC 2 cut(s) 1176, 1220
BsiHKCI CYCGRG 2 cut(s) 1169, 1274
BsiSI CCGG 1 cut(s) 582
BslFI GGGAC 4 cut(s) 1005, 1120, 1220, 1238
BslI CCNNNNNNNGG 3 cut(s) 753, 777, 1188
BsmFI GGGAC 4 cut(s) 1005, 1120, 1220, 1238
BsmI GAATGC 1 cut(s) 368
BsnI GGCC 2 cut(s) 699, 879
BsoBI CYCGRG 2 cut(s) 1169, 1274
Bsp1286I GDGCHC 4 cut(s) 784, 1176, 1220, 1410
Bsp143I GATC 1 cut(s) 985
BspACI CCGC 7 cut(s) 609, 629, 639, 650, 775, 969, 1086
BspANI GGCC 2 cut(s) 699, 879
BspCNI CTCAG 5 cut(s) 425, 518, 864, 1023, 1389
BspHI TCATGA 1 cut(s) 1212
BspLI GGNNCC 2 cut(s) 431, 783
BspMAI CTGCAG 5 cut(s) 403, 496, 529, 595, 619
BspQI GCTCTTC 1 cut(s) 1181
BspT107I GGYRCC 2 cut(s) 429, 781
BsrDI GCAATG 2 cut(s) 963, 1297
BsrFI RCCGGY 1 cut(s) 581
BsrI ACTGG 4 cut(s) 272, 794, 1053, 1094
BssAI RCCGGY 1 cut(s) 581
BssECI CCNNGG 1 cut(s) 433
BssMI GATC 1 cut(s) 985
Bst2UI CCWGG 4 cut(s) 288, 297, 434, 876
Bst4CI ACNGT 4 cut(s) 41, 205, 751, 1201
Bst6I CTCTTC 3 cut(s) 45, 117, 1181
BstAPI GCANNNNNTGC 1 cut(s) 524
BstBAI YACGTR 1 cut(s) 1336
BstC8I GCNNGC 2 cut(s) 110, 637
BstDEI CTNAG 6 cut(s) 159, 412, 505, 851, 1031, 1376
BstF5I GGATG 1 cut(s) 666
BstHHI GCGC 1 cut(s) 554
BstKTI GATC 1 cut(s) 988
BstMBI GATC 1 cut(s) 985
BstNI CCWGG 4 cut(s) 288, 297, 434, 876
BstNSI RCATGY 2 cut(s) 26, 1269
BstSCI CCNGG 4 cut(s) 286, 295, 432, 874
BstSFI CTRYAG 5 cut(s) 399, 492, 525, 591, 615
BstSLI GKGCMC 1 cut(s) 784
BstV2I GAAGAC 1 cut(s) 1082
BstXI CCANNNNNNTGG 1 cut(s) 1241
BsuRI GGCC 2 cut(s) 699, 879
BtgZI GCGATG 3 cut(s) 354, 949, 1050
BtsCI GGATG 1 cut(s) 666
BtsIMutI CAGTG 2 cut(s) 1008, 1197
Cac8I GCNNGC 2 cut(s) 110, 637
CaiI CAGNNNCTG 3 cut(s) 383, 545, 686
CciI TCATGA 1 cut(s) 1212
CfoI GCGC 1 cut(s) 554
Cfr10I RCCGGY 1 cut(s) 581
Cfr13I GGNCC 2 cut(s) 584, 697
CseI GACGC 1 cut(s) 811
Csp6I GTAC 3 cut(s) 206, 430, 860
CspAI ACCGGT 1 cut(s) 581
CviAII CATG 5 cut(s) 23, 923, 1213, 1266, 1432
CviQI GTAC 3 cut(s) 206, 430, 860
DdeI CTNAG 6 cut(s) 159, 412, 505, 851, 1031, 1376
DpnI GATC 1 cut(s) 987
DpnII GATC 1 cut(s) 985
EaeI YGGCCR 1 cut(s) 877
Eam1104I CTCTTC 3 cut(s) 45, 117, 1181
EarI CTCTTC 3 cut(s) 45, 117, 1181
EciI GGCGGA 1 cut(s) 654
Ecl136II GAGCTC 1 cut(s) 1174
Eco24I GRGCYC 2 cut(s) 1176, 1410
Eco32I GATATC 1 cut(s) 1147
Eco47I GGWCC 1 cut(s) 584
Eco53kI GAGCTC 1 cut(s) 1174
Eco57I CTGAAG 1 cut(s) 498
Eco88I CYCGRG 2 cut(s) 1169, 1274
EcoICRI GAGCTC 1 cut(s) 1174
EcoRII CCWGG 4 cut(s) 286, 295, 432, 874
EcoRV GATATC 1 cut(s) 1147
EcoT38I GRGCYC 2 cut(s) 1176, 1410
FaeI CATG 5 cut(s) 26, 926, 1216, 1269, 1435
FalI AAGNNNNNCTT 1 cut(s) 31
FaqI GGGAC 4 cut(s) 1005, 1120, 1220, 1238
FatI CATG 5 cut(s) 22, 922, 1212, 1265, 1431
FauNDI CATATG 1 cut(s) 138
FokI GGATG 1 cut(s) 673
FriOI GRGCYC 2 cut(s) 1176, 1410
FspBI CTAG 2 cut(s) 11, 488
GlaI GCGC 1 cut(s) 553
GsaI CCCAGC 3 cut(s) 398, 781, 1259
GsuI CTGGAG 1 cut(s) 318
HaeIII GGCC 2 cut(s) 699, 879
HapII CCGG 1 cut(s) 582
HgaI GACGC 1 cut(s) 811
HhaI GCGC 1 cut(s) 554
Hin1II CATG 5 cut(s) 26, 926, 1216, 1269, 1435
Hin6I GCGC 1 cut(s) 552
HinP1I GCGC 1 cut(s) 552
HincII GTYRAC 2 cut(s) 606, 744
HindII GTYRAC 2 cut(s) 606, 744
HindIII AAGCTT 1 cut(s) 1053
HinfI GANTC 7 cut(s) 99, 188, 316, 352, 438, 1277, 1329
HpaI GTTAAC 1 cut(s) 606
HpaII CCGG 1 cut(s) 582
HphI GGTGA 1 cut(s) 1364
Hpy166II GTNNAC 4 cut(s) 606, 744, 1008, 1281
Hpy188I TCNGA 8 cut(s) 49, 63, 98, 361, 415, 985, 1151, 1379
Hpy8I GTNNAC 4 cut(s) 606, 744, 1008, 1281
HpyAV CCTTC 7 cut(s) 745, 781, 800, 939, 1097, 1343, 1441
HpyCH4III ACNGT 4 cut(s) 41, 205, 751, 1201
HpyCH4IV ACGT 1 cut(s) 1335
HpyF3I CTNAG 6 cut(s) 159, 412, 505, 851, 1031, 1376
HpySE526I ACGT 1 cut(s) 1335
Hsp92II CATG 5 cut(s) 26, 926, 1216, 1269, 1435
HspAI GCGC 1 cut(s) 552
KpnI GGTACC 1 cut(s) 433
KspAI GTTAAC 1 cut(s) 606
Kzo9I GATC 1 cut(s) 985
LguI GCTCTTC 1 cut(s) 1181
LmnI GCTCC 5 cut(s) 385, 542, 560, 623, 679
LweI GCATC 4 cut(s) 331, 661, 926, 1443
MaeI CTAG 2 cut(s) 11, 488
MaeII ACGT 1 cut(s) 1335
MaeIII GTNAC 1 cut(s) 577
MalI GATC 1 cut(s) 987
MboI GATC 1 cut(s) 985
MboII GAAGA 6 cut(s) 62, 134, 229, 1075, 1082, 1168
MfeI CAATTG 2 cut(s) 555, 915
MhlI GDGCHC 4 cut(s) 784, 1176, 1220, 1410
MlsI TGGCCA 1 cut(s) 879
MluCI AATT 8 cut(s) 64, 221, 555, 692, 915, 1080, 1183, 1260
MluNI TGGCCA 1 cut(s) 879
MlyI GAGTC 1 cut(s) 1286
MmeI TCCRAC 2 cut(s) 453, 601
MnlI CCTC 5 cut(s) 22, 235, 289, 293, 1009
Mox20I TGGCCA 1 cut(s) 879
MscI TGGCCA 1 cut(s) 879
MseI TTAA 4 cut(s) 129, 248, 605, 765
MslI CAYNNNNRTG 1 cut(s) 1422
Msp20I TGGCCA 1 cut(s) 879
MspA1I CMGCKG 5 cut(s) 398, 524, 611, 683, 777
MspI CCGG 1 cut(s) 582
MspR9I CCNGG 4 cut(s) 288, 297, 434, 876
MunI CAATTG 2 cut(s) 555, 915
Mva1269I GAATGC 1 cut(s) 368
MvaI CCWGG 4 cut(s) 288, 297, 434, 876
NdeI CATATG 1 cut(s) 138
NdeII GATC 1 cut(s) 985
NlaIII CATG 5 cut(s) 26, 926, 1216, 1269, 1435
NlaIV GGNNCC 2 cut(s) 431, 783
NmuCI GTSAC 1 cut(s) 577
NspI RCATGY 2 cut(s) 26, 1269
PaeR7I CTCGAG 1 cut(s) 1274
PagI TCATGA 1 cut(s) 1212
PciSI GCTCTTC 1 cut(s) 1181
PctI GAATGC 1 cut(s) 368
PfeI GAWTC 6 cut(s) 99, 188, 316, 352, 438, 1329
PfoI TCCNGGA 2 cut(s) 286, 295
PinAI ACCGGT 1 cut(s) 581
PleI GAGTC 1 cut(s) 1285
PpsI GAGTC 1 cut(s) 1285
Ppu21I YACGTR 1 cut(s) 1336
Psp124BI GAGCTC 1 cut(s) 1176
Psp6I CCWGG 4 cut(s) 286, 295, 432, 874
PspFI CCCAGC 3 cut(s) 394, 777, 1255
PspGI CCWGG 4 cut(s) 286, 295, 432, 874
PspN4I GGNNCC 2 cut(s) 431, 783
PspPI GGNCC 2 cut(s) 584, 697
PstI CTGCAG 5 cut(s) 403, 496, 529, 595, 619
PstNI CAGNNNCTG 3 cut(s) 383, 545, 686
PvuII CAGCTG 3 cut(s) 398, 524, 683
RsaI GTAC 3 cut(s) 207, 431, 861
RsaNI GTAC 3 cut(s) 206, 430, 860
RseI CAYNNNNRTG 1 cut(s) 1422
SacI GAGCTC 1 cut(s) 1176
SapI GCTCTTC 1 cut(s) 1181
SaqAI TTAA 4 cut(s) 129, 248, 605, 765
Sau3AI GATC 1 cut(s) 985
Sau96I GGNCC 2 cut(s) 584, 697
SchI GAGTC 1 cut(s) 1286
ScrFI CCNGG 4 cut(s) 288, 297, 434, 876
SduI GDGCHC 4 cut(s) 784, 1176, 1220, 1410
SfaNI GCATC 4 cut(s) 331, 661, 926, 1443
SfcI CTRYAG 5 cut(s) 399, 492, 525, 591, 615
Sfr274I CTCGAG 1 cut(s) 1274
SinI GGWCC 1 cut(s) 584
SlaI CTCGAG 1 cut(s) 1274
SmiMI CAYNNNNRTG 1 cut(s) 1422
SmlI CTYRAG 2 cut(s) 929, 1274
SmoI CTYRAG 2 cut(s) 929, 1274
Sse9I AATT 8 cut(s) 64, 221, 555, 692, 915, 1080, 1183, 1260
SsiI CCGC 7 cut(s) 609, 629, 639, 650, 775, 969, 1086
SspI AATATT 2 cut(s) 175, 1240
SspMI CTAG 2 cut(s) 11, 488
SstI GAGCTC 1 cut(s) 1176
StyD4I CCNGG 4 cut(s) 286, 295, 432, 874
TaaI ACNGT 4 cut(s) 41, 205, 751, 1201
TaiI ACGT 1 cut(s) 1338
TaqI TCGA 2 cut(s) 1226, 1275
TasI AATT 8 cut(s) 64, 221, 555, 692, 915, 1080, 1183, 1260
TatI WGTACW 1 cut(s) 205
TauI GCSGC 1 cut(s) 971
TfiI GAWTC 6 cut(s) 99, 188, 316, 352, 438, 1329
Tru1I TTAA 4 cut(s) 129, 248, 605, 765
Tru9I TTAA 4 cut(s) 129, 248, 605, 765
TscAI CASTG 2 cut(s) 1015, 1204
TseFI GTSAC 1 cut(s) 577
Tsp45I GTSAC 1 cut(s) 577
TspDTI ATGAA 6 cut(s) 705, 744, 911, 1201, 1313, 1387
TspGWI ACGGA 1 cut(s) 1309
TspRI CASTG 2 cut(s) 1015, 1204
VpaK11BI GGWCC 1 cut(s) 584
XapI RAATTY 1 cut(s) 64
XceI RCATGY 2 cut(s) 26, 1269
XhoI CTCGAG 1 cut(s) 1274
XspI CTAG 2 cut(s) 11, 488
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.