pycom17g12270

Possibly involved in carbohydrate binding

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
9981386 .. 9982018
633 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g12270.2

Sequence Viewer

Length: 588 bp
ATGTTGGCTTCCCCAAATATTGAATTCCAACAGTTCGATGCCAGCTCTCCCTTCTCATCACCAGCGTTGGATTCACCAGCACCGGGACATCTCCCTCTTCCAGCGCCAAACTTCGTATCCCCACCAATTCCTCCAAACCCACCTCTTGCAAATCCTCTTCCATCTGGCCCACACCCACCAACCAAAATCCCAACCCCACCCAAATCAGTCCTGAGCCCACCAGTTCTTCCGCCGCCAATAGCTTTCCCTCCACCGACCGGACCGCCATCCCCTCCGCAGAAAAAGCCGCCGCAGTTTGCCGTGTGGTGCGTGGTGAAGCCGACAGTGCCGGACCCGATAATCCAAGAAGCCCTGGACTATGCGTGTGGGTCCGGGGTAGACTGCAAGTCAATCCGGCCCAATGGGTCCTGCTACCAGCTCGACACATTGTTGTCGCATGCTTCCCATGCCTTCAATAGTTACCGGCAGAACACGGAGATCGCTGGAGGCACTTGTCACTTTGGAGGAATTGCCATGCTTGTCACAGTTGATCCAAGTAAGTCCAAATTTTCCCCATATCAAGATATTATTTTGGCATATTGCATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

196

Amino Acids

20.58

Weight (kDa)

6.48

Isoelectric Point (pI)

71.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012900)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 378
AciI CCGC 6 cut(s) 230, 233, 263, 275, 287, 290
AclWI GGATC 1 cut(s) 524
AcsI RAATTY 2 cut(s) 23, 545
AfiI CCNNNNNNNGG 2 cut(s) 83, 257
AgsI TTSAA 2 cut(s) 23, 454
AhdI GACNNNNNGTC 1 cut(s) 385
AjnI CCWGG 1 cut(s) 351
AluBI AGCT 3 cut(s) 45, 242, 418
AluI AGCT 3 cut(s) 45, 242, 418
AlwI GGATC 1 cut(s) 524
AoxI GGCC 2 cut(s) 166, 395
ApoI RAATTY 2 cut(s) 23, 545
AspLEI GCGC 1 cut(s) 106
AspS9I GGNCC 6 cut(s) 167, 260, 331, 369, 396, 405
AsuC2I CCSGG 2 cut(s) 84, 373
AsuHPI GGTGA 3 cut(s) 51, 66, 325
AvaII GGWCC 4 cut(s) 260, 331, 369, 405
BanII GRGCYC 1 cut(s) 218
BccI CCATC 2 cut(s) 169, 274
BceAI ACGGC 1 cut(s) 284
BciT130I CCWGG 1 cut(s) 353
BciVI GTATCC 1 cut(s) 127
BcnI CCSGG 2 cut(s) 84, 373
BfoI RGCGCY 1 cut(s) 107
BfuI GTATCC 1 cut(s) 127
BisI GCNGC 3 cut(s) 233, 287, 290
BlsI GCNGC 3 cut(s) 234, 288, 291
Bme1390I CCNGG 3 cut(s) 84, 353, 373
Bme18I GGWCC 4 cut(s) 260, 331, 369, 405
BmeRI GACNNNNNGTC 1 cut(s) 385
BmgT120I GGNCC 6 cut(s) 167, 260, 331, 369, 396, 405
BmiI GGNNCC 3 cut(s) 333, 370, 406
BmrFI CCNGG 3 cut(s) 84, 353, 373
BmsI GCATC 1 cut(s) 28
BpmI CTGGAG 1 cut(s) 504
Bpu10I CCTNAGC 1 cut(s) 212
BpuMI CCSGG 2 cut(s) 84, 373
BsaJI CCNNGG 2 cut(s) 351, 372
BsaWI WCCGGW 1 cut(s) 257
Bsc4I CCNNNNNNNGG 2 cut(s) 83, 257
Bse118I RCCGGY 1 cut(s) 462
Bse1I ACTGG 1 cut(s) 221
BseBI CCWGG 1 cut(s) 353
BseDI CCNNGG 2 cut(s) 351, 372
BseGI GGATG 1 cut(s) 266
BseLI CCNNNNNNNGG 2 cut(s) 83, 257
BseMII CTCAG 1 cut(s) 203
BseNI ACTGG 1 cut(s) 221
Bsh1285I CGRYCG 1 cut(s) 258
BshFI GGCC 2 cut(s) 168, 397
BsiEI CGRYCG 1 cut(s) 258
BsiSI CCGG 6 cut(s) 83, 258, 329, 372, 394, 463
BslFI GGGAC 1 cut(s) 99
BslI CCNNNNNNNGG 2 cut(s) 83, 257
BsmFI GGGAC 1 cut(s) 99
BsnI GGCC 2 cut(s) 168, 397
Bsp1286I GDGCHC 1 cut(s) 218
Bsp143I GATC 2 cut(s) 477, 529
BspACI CCGC 6 cut(s) 230, 233, 263, 275, 287, 290
BspANI GGCC 2 cut(s) 168, 397
BspCNI CTCAG 1 cut(s) 204
BspLI GGNNCC 3 cut(s) 333, 370, 406
BspPI GGATC 1 cut(s) 524
BsrFI RCCGGY 1 cut(s) 462
BsrI ACTGG 1 cut(s) 221
BssAI RCCGGY 1 cut(s) 462
BssECI CCNNGG 2 cut(s) 351, 372
BssMI GATC 2 cut(s) 477, 529
Bst2UI CCWGG 1 cut(s) 353
Bst4CI ACNGT 3 cut(s) 33, 325, 526
Bst6I CTCTTC 2 cut(s) 102, 162
BstC8I GCNNGC 2 cut(s) 43, 438
BstDEI CTNAG 1 cut(s) 212
BstF5I GGATG 1 cut(s) 266
BstH2I RGCGCY 1 cut(s) 107
BstHHI GCGC 1 cut(s) 106
BstKTI GATC 2 cut(s) 480, 532
BstMBI GATC 2 cut(s) 477, 529
BstMCI CGRYCG 1 cut(s) 258
BstMWI GCNNNNNNNGC 3 cut(s) 283, 325, 446
BstNI CCWGG 1 cut(s) 353
BstNSI RCATGY 1 cut(s) 440
BstSCI CCNGG 3 cut(s) 82, 351, 371
BsuI GTATCC 1 cut(s) 127
BsuRI GGCC 2 cut(s) 168, 397
BtsCI GGATG 1 cut(s) 266
BtsIMutI CAGTG 1 cut(s) 330
Cac8I GCNNGC 2 cut(s) 43, 438
CfoI GCGC 1 cut(s) 106
Cfr10I RCCGGY 1 cut(s) 462
Cfr13I GGNCC 6 cut(s) 167, 260, 331, 369, 396, 405
CpoI CGGWCCG 1 cut(s) 260
CspI CGGWCCG 1 cut(s) 260
CviAII CATG 3 cut(s) 437, 446, 514
DdeI CTNAG 1 cut(s) 212
DpnI GATC 2 cut(s) 479, 531
DpnII GATC 2 cut(s) 477, 529
DriI GACNNNNNGTC 1 cut(s) 385
Eam1104I CTCTTC 2 cut(s) 102, 162
Eam1105I GACNNNNNGTC 1 cut(s) 385
EarI CTCTTC 2 cut(s) 102, 162
EciI GGCGGA 1 cut(s) 219
Eco24I GRGCYC 1 cut(s) 218
Eco47I GGWCC 4 cut(s) 260, 331, 369, 405
EcoO109I RGGNCCY 1 cut(s) 405
EcoRI GAATTC 1 cut(s) 23
EcoRII CCWGG 1 cut(s) 351
EcoT38I GRGCYC 1 cut(s) 218
FaeI CATG 3 cut(s) 440, 449, 517
FaiI YATR 6 cut(s) 360, 438, 447, 515, 556, 577
FaqI GGGAC 1 cut(s) 99
FatI CATG 3 cut(s) 436, 445, 513
FblI GTMKAC 1 cut(s) 378
Fnu4HI GCNGC 3 cut(s) 233, 287, 290
FokI GGATG 1 cut(s) 253
FriOI GRGCYC 1 cut(s) 218
Fsp4HI GCNGC 3 cut(s) 233, 287, 290
GlaI GCGC 1 cut(s) 105
GluI GCNGC 3 cut(s) 233, 287, 290
GsuI CTGGAG 1 cut(s) 504
HaeII RGCGCY 1 cut(s) 107
HaeIII GGCC 2 cut(s) 168, 397
HapII CCGG 6 cut(s) 83, 258, 329, 372, 394, 463
HhaI GCGC 1 cut(s) 106
Hin1II CATG 3 cut(s) 440, 449, 517
Hin6I GCGC 1 cut(s) 104
HinP1I GCGC 1 cut(s) 104
HinfI GANTC 1 cut(s) 71
HpaII CCGG 6 cut(s) 83, 258, 329, 372, 394, 463
HphI GGTGA 3 cut(s) 51, 66, 325
Hpy166II GTNNAC 1 cut(s) 379
Hpy188III TCNNGA 2 cut(s) 211, 560
Hpy8I GTNNAC 1 cut(s) 379
HpyAV CCTTC 2 cut(s) 61, 460
HpyCH4III ACNGT 3 cut(s) 33, 325, 526
HpyCH4V TGCA 3 cut(s) 149, 384, 582
HpyF10VI GCNNNNNNNGC 3 cut(s) 283, 325, 446
HpyF3I CTNAG 1 cut(s) 212
Hsp92II CATG 3 cut(s) 440, 449, 517
HspAI GCGC 1 cut(s) 104
Kzo9I GATC 2 cut(s) 477, 529
LweI GCATC 1 cut(s) 28
MaeIII GTNAC 3 cut(s) 458, 494, 520
MalI GATC 2 cut(s) 479, 531
MboI GATC 2 cut(s) 477, 529
MboII GAAGA 3 cut(s) 89, 149, 218
MhlI GDGCHC 1 cut(s) 218
MluCI AATT 4 cut(s) 23, 126, 507, 545
MmeI TCCRAC 2 cut(s) 48, 52
MnlI CCTC 8 cut(s) 105, 141, 153, 165, 258, 282, 479, 497
MspI CCGG 6 cut(s) 83, 258, 329, 372, 394, 463
MspR9I CCNGG 3 cut(s) 84, 353, 373
MvaI CCWGG 1 cut(s) 353
MwoI GCNNNNNNNGC 3 cut(s) 283, 325, 446
NciI CCSGG 2 cut(s) 84, 373
NdeII GATC 2 cut(s) 477, 529
NlaIII CATG 3 cut(s) 440, 449, 517
NlaIV GGNNCC 3 cut(s) 333, 370, 406
NmuCI GTSAC 2 cut(s) 494, 520
NspI RCATGY 1 cut(s) 440
PaeI GCATGC 1 cut(s) 440
PfeI GAWTC 1 cut(s) 71
PkrI GCNGC 3 cut(s) 234, 288, 291
PpuMI RGGWCCY 1 cut(s) 405
Psp5II RGGWCCY 1 cut(s) 405
Psp6I CCWGG 1 cut(s) 351
PspGI CCWGG 1 cut(s) 351
PspN4I GGNNCC 3 cut(s) 333, 370, 406
PspPI GGNCC 6 cut(s) 167, 260, 331, 369, 396, 405
PspPPI RGGWCCY 1 cut(s) 405
Rsr2I CGGWCCG 1 cut(s) 260
RsrII CGGWCCG 1 cut(s) 260
SatI GCNGC 3 cut(s) 233, 287, 290
Sau3AI GATC 2 cut(s) 477, 529
Sau96I GGNCC 6 cut(s) 167, 260, 331, 369, 396, 405
ScrFI CCNGG 3 cut(s) 84, 353, 373
SduI GDGCHC 1 cut(s) 218
SetI ASST 4 cut(s) 47, 145, 244, 420
SfaNI GCATC 1 cut(s) 28
SinI GGWCC 4 cut(s) 260, 331, 369, 405
SphI GCATGC 1 cut(s) 440
Sse9I AATT 4 cut(s) 23, 126, 507, 545
SsiI CCGC 6 cut(s) 230, 233, 263, 275, 287, 290
SspI AATATT 1 cut(s) 19
StyD4I CCNGG 3 cut(s) 82, 351, 371
TaaI ACNGT 3 cut(s) 33, 325, 526
TaqI TCGA 2 cut(s) 36, 420
TasI AATT 4 cut(s) 23, 126, 507, 545
TauI GCSGC 3 cut(s) 235, 289, 292
TfiI GAWTC 1 cut(s) 71
TscAI CASTG 1 cut(s) 330
TseFI GTSAC 2 cut(s) 494, 520
Tsp45I GTSAC 2 cut(s) 494, 520
TspGWI ACGGA 1 cut(s) 488
TspRI CASTG 1 cut(s) 330
VpaK11BI GGWCC 4 cut(s) 260, 331, 369, 405
XapI RAATTY 2 cut(s) 23, 545
XceI RCATGY 1 cut(s) 440
XmiI GTMKAC 1 cut(s) 378
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.