pycom17g21380

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
19759354 .. 19759584
231 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 231 bp
ATGTCTATTTTCTGGAGCATTTCGCGGATTGTTAATATCATTTTTCTAGAAGAAGTTATGGCCGTTTTAACATTGAAAGGTTCCCAAGAGGCTAAGCAGTTTGTAACTGACAAGAAAGCATTGAAAGCAATAAATCCAATAAAACTAGCAGCCAAAACTGATGCAATCAAGAACAAACCAGCTGACACCTATTCAAATATCAGAGGAAATGGAATTAAAGATGAGGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

77

Amino Acids

8.45

Weight (kDa)

9.35

Isoelectric Point (pI)

30.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 25
AciI CCGC 1 cut(s) 25
AcoI YGGCCR 1 cut(s) 60
AgsI TTSAA 3 cut(s) 76, 124, 195
AluBI AGCT 1 cut(s) 182
AluI AGCT 1 cut(s) 182
AoxI GGCC 1 cut(s) 60
ApeKI GCWGC 1 cut(s) 149
BbvI GCAGC 1 cut(s) 161
BceAI ACGGC 1 cut(s) 47
BfaI CTAG 2 cut(s) 47, 146
BisI GCNGC 1 cut(s) 150
BlpI GCTNAGC 1 cut(s) 93
BlsI GCNGC 1 cut(s) 151
BmiI GGNNCC 1 cut(s) 82
BmsI GCATC 1 cut(s) 151
BpmI CTGGAG 1 cut(s) 34
Bpu1102I GCTNAGC 1 cut(s) 93
BseXI GCAGC 1 cut(s) 161
Bsh1236I CGCG 1 cut(s) 25
BshFI GGCC 1 cut(s) 62
BsnI GGCC 1 cut(s) 62
Bsp1720I GCTNAGC 1 cut(s) 93
BspACI CCGC 1 cut(s) 25
BspANI GGCC 1 cut(s) 62
BspFNI CGCG 1 cut(s) 25
BspLI GGNNCC 1 cut(s) 82
BstDEI CTNAG 1 cut(s) 93
BstFNI CGCG 1 cut(s) 25
BstMWI GCNNNNNNNGC 1 cut(s) 125
BstUI CGCG 1 cut(s) 25
BstV1I GCAGC 1 cut(s) 161
BsuRI GGCC 1 cut(s) 62
CviJI RGCY 4 cut(s) 62, 92, 152, 182
CviKI_1 RGCY 4 cut(s) 62, 92, 152, 182
DdeI CTNAG 1 cut(s) 93
EaeI YGGCCR 1 cut(s) 60
FaiI YATR 1 cut(s) 59
Fnu4HI GCNGC 1 cut(s) 150
Fsp4HI GCNGC 1 cut(s) 150
FspBI CTAG 2 cut(s) 47, 146
GluI GCNGC 1 cut(s) 150
GsuI CTGGAG 1 cut(s) 34
HaeIII GGCC 1 cut(s) 62
Hpy188I TCNGA 1 cut(s) 203
Hpy188III TCNNGA 3 cut(s) 13, 47, 169
HpyCH4V TGCA 1 cut(s) 164
HpyF10VI GCNNNNNNNGC 1 cut(s) 125
HpyF3I CTNAG 1 cut(s) 93
LmnI GCTCC 1 cut(s) 15
LpnPI CCDG 1 cut(s) 192
Lsp1109I GCAGC 1 cut(s) 161
LweI GCATC 1 cut(s) 151
MaeI CTAG 2 cut(s) 47, 146
MaeIII GTNAC 1 cut(s) 103
MboII GAAGA 1 cut(s) 62
MluCI AATT 1 cut(s) 213
MnlI CCTC 3 cut(s) 82, 197, 217
MseI TTAA 4 cut(s) 33, 68, 216, 229
MspA1I CMGCKG 1 cut(s) 182
MvnI CGCG 1 cut(s) 25
MwoI GCNNNNNNNGC 1 cut(s) 125
NlaIV GGNNCC 1 cut(s) 82
PkrI GCNGC 1 cut(s) 151
PspN4I GGNNCC 1 cut(s) 82
PvuII CAGCTG 1 cut(s) 182
SaqAI TTAA 4 cut(s) 33, 68, 216, 229
SatI GCNGC 1 cut(s) 150
SetI ASST 3 cut(s) 82, 184, 191
SfaNI GCATC 1 cut(s) 151
SgeI CNNG 8 cut(s) 25, 36, 59, 98, 124, 158, 181, 191
Sse9I AATT 1 cut(s) 213
SsiI CCGC 1 cut(s) 25
SspMI CTAG 2 cut(s) 47, 146
TasI AATT 1 cut(s) 213
Tru1I TTAA 4 cut(s) 33, 68, 216, 229
Tru9I TTAA 4 cut(s) 33, 68, 216, 229
TseI GCWGC 1 cut(s) 149
XbaI TCTAGA 1 cut(s) 46
XspI CTAG 2 cut(s) 47, 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.