pycom17g25520

Zinc-finger of C2H2 type

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
OG0006812
Physical Location & Seq
Forward (+)
23632660 .. 23633751
1092 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 492 bp
ATGCCAGGTCTACCAATAACTGAAGATGATGATGCTTCAACAGGACATGAAATACCAGATCTTATTGCCGGTCAGTTGCTTGGTAAAAGTGGTTCAGAATTACTAGAGGAAGAATCTAACATCATGCCAGACGAGGAATCAATACCGTTAGATTTACCGGACTGTATCGTGAAATGCAAATCAGCTTTCAAATGCAGGTTATGCCCTAGAATTGTCCGTTTGAATGAGGAGAGTTTAAGGGCTCATCTGAAATCCAAGAGACATGCTCGATCTAAGAAACTATTAGACGAAGGTAGGCTGAAGACCATACTGAACGCTGATGGGAAAATTGATGAAGAGGAGACCCCTGCTTTATATGCAAAAATTCTAGCTAATTCACAGGGTATGCCGAGAAAGAGAAGTAAAAGACGGGACAAGAATGGGTCGAAAAAGAGGACGAGATATGGTGGTAAGCAATCCAAAGGGAACCCAGCCAAGAGAAGGCATGGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
zf-met

Protein Analysis

164

Amino Acids

18.19

Weight (kDa)

9.49

Isoelectric Point (pI)

67.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 186
AccI GTMKAC 1 cut(s) 10
AcsI RAATTY 1 cut(s) 363
AcuI CTGAAG 2 cut(s) 42, 320
AfiI CCNNNNNNNGG 1 cut(s) 480
AgsI TTSAA 3 cut(s) 39, 190, 223
AjnI CCWGG 1 cut(s) 4
AluBI AGCT 2 cut(s) 185, 371
AluI AGCT 2 cut(s) 185, 371
Alw26I GTCTC 2 cut(s) 253, 335
ApoI RAATTY 1 cut(s) 363
BanII GRGCYC 1 cut(s) 244
BbsI GAAGAC 1 cut(s) 308
BccI CCATC 1 cut(s) 314
BciT130I CCWGG 1 cut(s) 6
BcoDI GTCTC 2 cut(s) 253, 335
BfaI CTAG 3 cut(s) 104, 207, 368
BfuAI ACCTGC 1 cut(s) 186
BglII AGATCT 1 cut(s) 58
Bme1390I CCNGG 1 cut(s) 6
BmiI GGNNCC 1 cut(s) 467
BmrFI CCNGG 1 cut(s) 6
BmsI GCATC 1 cut(s) 22
BpiI GAAGAC 1 cut(s) 308
BplI GAGNNNNNCTC 2 cut(s) 250, 282
BsaI GGTCTC 1 cut(s) 335
BsaWI WCCGGW 1 cut(s) 157
Bsc4I CCNNNNNNNGG 1 cut(s) 480
Bse118I RCCGGY 1 cut(s) 68
BseBI CCWGG 1 cut(s) 6
BseLI CCNNNNNNNGG 1 cut(s) 480
BseRI GAGGAG 2 cut(s) 242, 353
BseYI CCCAGC 1 cut(s) 469
BsiSI CCGG 2 cut(s) 69, 158
BslFI GGGAC 1 cut(s) 425
BslI CCNNNNNNNGG 1 cut(s) 480
BsmAI GTCTC 2 cut(s) 253, 335
BsmFI GGGAC 1 cut(s) 425
Bso31I GGTCTC 1 cut(s) 335
Bsp1286I GDGCHC 1 cut(s) 244
Bsp143I GATC 2 cut(s) 58, 269
BspLI GGNNCC 1 cut(s) 467
BspMI ACCTGC 1 cut(s) 186
BspTNI GGTCTC 1 cut(s) 335
BsrFI RCCGGY 1 cut(s) 68
BssAI RCCGGY 1 cut(s) 68
BssMI GATC 2 cut(s) 58, 269
Bst2UI CCWGG 1 cut(s) 6
Bst4CI ACNGT 2 cut(s) 147, 164
Bst6I CTCTTC 1 cut(s) 330
BstAPI GCANNNNNTGC 1 cut(s) 201
BstDEI CTNAG 1 cut(s) 273
BstKTI GATC 2 cut(s) 61, 272
BstMAI GTCTC 2 cut(s) 253, 335
BstMBI GATC 2 cut(s) 58, 269
BstMWI GCNNNNNNNGC 2 cut(s) 201, 356
BstNI CCWGG 1 cut(s) 6
BstNSI RCATGY 1 cut(s) 266
BstSCI CCNGG 1 cut(s) 4
BstV2I GAAGAC 1 cut(s) 308
BstX2I RGATCY 1 cut(s) 58
BstYI RGATCY 1 cut(s) 58
BveI ACCTGC 1 cut(s) 186
Cfr10I RCCGGY 1 cut(s) 68
CviAII CATG 4 cut(s) 47, 124, 263, 485
CviJI RGCY 5 cut(s) 185, 242, 298, 371, 473
CviKI_1 RGCY 5 cut(s) 185, 242, 298, 371, 473
DdeI CTNAG 1 cut(s) 273
DpnI GATC 2 cut(s) 60, 271
DpnII GATC 2 cut(s) 58, 269
Eam1104I CTCTTC 1 cut(s) 330
EarI CTCTTC 1 cut(s) 330
Eco24I GRGCYC 1 cut(s) 244
Eco31I GGTCTC 1 cut(s) 335
Eco57I CTGAAG 2 cut(s) 42, 320
EcoRII CCWGG 1 cut(s) 4
EcoT38I GRGCYC 1 cut(s) 244
FaeI CATG 4 cut(s) 50, 127, 266, 488
FaqI GGGAC 1 cut(s) 425
FatI CATG 4 cut(s) 46, 123, 262, 484
FblI GTMKAC 1 cut(s) 10
FriOI GRGCYC 1 cut(s) 244
FspBI CTAG 3 cut(s) 104, 207, 368
GsaI CCCAGC 1 cut(s) 473
HapII CCGG 2 cut(s) 69, 158
Hin1II CATG 4 cut(s) 50, 127, 266, 488
HinfI GANTC 2 cut(s) 113, 137
HpaII CCGG 2 cut(s) 69, 158
Hpy166II GTNNAC 1 cut(s) 11
Hpy188I TCNGA 2 cut(s) 97, 249
Hpy188III TCNNGA 1 cut(s) 169
Hpy8I GTNNAC 1 cut(s) 11
HpyAV CCTTC 2 cut(s) 284, 474
HpyCH4III ACNGT 2 cut(s) 147, 164
HpyCH4V TGCA 3 cut(s) 177, 195, 359
HpyF10VI GCNNNNNNNGC 2 cut(s) 201, 356
HpyF3I CTNAG 1 cut(s) 273
Hsp92II CATG 4 cut(s) 50, 127, 266, 488
Kzo9I GATC 2 cut(s) 58, 269
LweI GCATC 1 cut(s) 22
MaeI CTAG 3 cut(s) 104, 207, 368
MalI GATC 2 cut(s) 60, 271
MboI GATC 2 cut(s) 58, 269
MboII GAAGA 4 cut(s) 35, 122, 313, 347
MflI RGATCY 1 cut(s) 58
MhlI GDGCHC 1 cut(s) 244
MluCI AATT 5 cut(s) 98, 210, 327, 363, 373
MnlI CCTC 5 cut(s) 100, 127, 220, 331, 426
MseI TTAA 1 cut(s) 236
MspI CCGG 2 cut(s) 69, 158
MspR9I CCNGG 1 cut(s) 6
MvaI CCWGG 1 cut(s) 6
MwoI GCNNNNNNNGC 2 cut(s) 201, 356
NdeII GATC 2 cut(s) 58, 269
NlaIII CATG 4 cut(s) 50, 127, 266, 488
NlaIV GGNNCC 1 cut(s) 467
NmeAIII GCCGAG 1 cut(s) 414
NspI RCATGY 1 cut(s) 266
PfeI GAWTC 2 cut(s) 113, 137
Psp6I CCWGG 1 cut(s) 4
PspFI CCCAGC 1 cut(s) 469
PspGI CCWGG 1 cut(s) 4
PspN4I GGNNCC 1 cut(s) 467
PsrI GAACNNNNNNTAC 2 cut(s) 76, 108
PsuI RGATCY 1 cut(s) 58
SaqAI TTAA 1 cut(s) 236
Sau3AI GATC 2 cut(s) 58, 269
ScrFI CCNGG 1 cut(s) 6
SduI GDGCHC 1 cut(s) 244
SetI ASST 5 cut(s) 10, 187, 200, 295, 373
SfaNI GCATC 1 cut(s) 22
Sse9I AATT 5 cut(s) 98, 210, 327, 363, 373
SspMI CTAG 3 cut(s) 104, 207, 368
StyD4I CCNGG 1 cut(s) 4
TaaI ACNGT 2 cut(s) 147, 164
TaqI TCGA 2 cut(s) 268, 425
TasI AATT 5 cut(s) 98, 210, 327, 363, 373
TfiI GAWTC 2 cut(s) 113, 137
Tru1I TTAA 1 cut(s) 236
Tru9I TTAA 1 cut(s) 236
TspDTI ATGAA 2 cut(s) 63, 348
TspGWI ACGGA 1 cut(s) 206
XapI RAATTY 1 cut(s) 363
XceI RCATGY 1 cut(s) 266
XmiI GTMKAC 1 cut(s) 10
XspI CTAG 3 cut(s) 104, 207, 368
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.