pycom275g00050

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00000275
Physical Location & Seq
Forward (+)
24967 .. 25439
473 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom275g00050.2

Sequence Viewer

Length: 429 bp
ATGTTGTTCAATGGCATCTCATTTCTTCGGCTAATGTTCCCCATTTTCTGGCACCTATCACACTTAGAGCAAAAATCAAAAGCATCTTTGAATAAAGTAGGCCAAAAGAAACCAGATTGTAAAACCTTTAGAGATGTCTTTTTGGATGCTTTGTTGCTCACTCTCTGGGACACACCTCCTAATGATTTGATCAGGGCAATATTTAAACAAATATGGTTCGTCCCAAACGTAGTGCTTTACCATGGCAAGGAACTTCTTTCTTTCCTGAAAAGAAAGGTCATTTCTCATTATACCACAAGCAAGATAATTAACAAAATCTGCATACCATGGTTCTTTTTCTTGAACAATGATAGGAGCATATTCATGCGACTTAAATGGCTTGTTCTCGTGCATTTACGTTATGTTTCTTTAGTTATTTTAGTCCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

143

Amino Acids

16.95

Weight (kDa)

10.12

Isoelectric Point (pI)

25.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 51
AccB7I CCANNNNNTGG 1 cut(s) 48
AfiI CCNNNNNNNGG 2 cut(s) 48, 247
AgsI TTSAA 3 cut(s) 10, 91, 343
AoxI GGCC 1 cut(s) 100
BanI GGYRCC 1 cut(s) 51
BauI CACGAG 1 cut(s) 386
BclI TGATCA 1 cut(s) 189
BmiI GGNNCC 1 cut(s) 53
BmsI GCATC 3 cut(s) 24, 92, 136
BsaJI CCNNGG 2 cut(s) 241, 326
Bsc4I CCNNNNNNNGG 2 cut(s) 48, 247
BseDI CCNNGG 2 cut(s) 241, 326
BseGI GGATG 1 cut(s) 151
BseLI CCNNNNNNNGG 2 cut(s) 48, 247
BshFI GGCC 1 cut(s) 102
BshNI GGYRCC 1 cut(s) 51
BslFI GGGAC 2 cut(s) 182, 206
BslI CCNNNNNNNGG 2 cut(s) 48, 247
BsmFI GGGAC 2 cut(s) 182, 206
BsnI GGCC 1 cut(s) 102
Bsp143I GATC 1 cut(s) 189
Bsp19I CCATGG 2 cut(s) 241, 326
BspANI GGCC 1 cut(s) 102
BspLI GGNNCC 1 cut(s) 53
BspT107I GGYRCC 1 cut(s) 51
BssECI CCNNGG 2 cut(s) 241, 326
BssMI GATC 1 cut(s) 189
BssSI CACGAG 1 cut(s) 386
BssT1I CCWWGG 2 cut(s) 241, 326
Bst2BI CACGAG 1 cut(s) 386
BstDEI CTNAG 1 cut(s) 64
BstDSI CCRYGG 2 cut(s) 241, 326
BstF5I GGATG 1 cut(s) 151
BstKTI GATC 1 cut(s) 192
BstMBI GATC 1 cut(s) 189
BsuRI GGCC 1 cut(s) 102
BtgI CCRYGG 2 cut(s) 241, 326
BtsCI GGATG 1 cut(s) 151
CviAII CATG 3 cut(s) 242, 327, 364
CviJI RGCY 3 cut(s) 31, 102, 379
CviKI_1 RGCY 3 cut(s) 31, 102, 379
DdeI CTNAG 1 cut(s) 64
DpnI GATC 1 cut(s) 191
DpnII GATC 1 cut(s) 189
DraI TTTAAA 1 cut(s) 205
Eco130I CCWWGG 2 cut(s) 241, 326
EcoT14I CCWWGG 2 cut(s) 241, 326
ErhI CCWWGG 2 cut(s) 241, 326
FaeI CATG 3 cut(s) 245, 330, 367
FaiI YATR 8 cut(s) 214, 243, 291, 323, 328, 359, 365, 402
FaqI GGGAC 2 cut(s) 182, 206
FatI CATG 3 cut(s) 241, 326, 363
FbaI TGATCA 1 cut(s) 189
FokI GGATG 1 cut(s) 158
HaeIII GGCC 1 cut(s) 102
Hin1II CATG 3 cut(s) 245, 330, 367
Hpy188III TCNNGA 2 cut(s) 265, 340
HpyCH4IV ACGT 2 cut(s) 228, 397
HpyCH4V TGCA 2 cut(s) 321, 391
HpyF3I CTNAG 1 cut(s) 64
HpySE526I ACGT 2 cut(s) 228, 397
Hsp92II CATG 3 cut(s) 245, 330, 367
Ksp22I TGATCA 1 cut(s) 189
Kzo9I GATC 1 cut(s) 189
LmnI GCTCC 1 cut(s) 354
LpnPI CCDG 5 cut(s) 34, 126, 151, 178, 278
LweI GCATC 3 cut(s) 24, 92, 136
MaeII ACGT 2 cut(s) 228, 397
MalI GATC 1 cut(s) 191
MboI GATC 1 cut(s) 189
MboII GAAGA 1 cut(s) 17
MluCI AATT 1 cut(s) 306
MnlI CCTC 1 cut(s) 186
MseI TTAA 4 cut(s) 204, 309, 372, 427
MslI CAYNNNNRTG 1 cut(s) 362
NcoI CCATGG 2 cut(s) 241, 326
NdeII GATC 1 cut(s) 189
NlaIII CATG 3 cut(s) 245, 330, 367
NlaIV GGNNCC 1 cut(s) 53
PcsI WCGNNNNNNNCGW 1 cut(s) 225
PflMI CCANNNNNTGG 1 cut(s) 48
PspN4I GGNNCC 1 cut(s) 53
RseI CAYNNNNRTG 1 cut(s) 362
SaqAI TTAA 4 cut(s) 204, 309, 372, 427
Sau3AI GATC 1 cut(s) 189
SetI ASST 6 cut(s) 57, 128, 178, 231, 279, 400
SfaNI GCATC 3 cut(s) 24, 92, 136
SmiMI CAYNNNNRTG 1 cut(s) 362
Sse9I AATT 1 cut(s) 306
SspI AATATT 1 cut(s) 201
StyI CCWWGG 2 cut(s) 241, 326
TaiI ACGT 2 cut(s) 231, 400
TasI AATT 1 cut(s) 306
Tru1I TTAA 4 cut(s) 204, 309, 372, 427
Tru9I TTAA 4 cut(s) 204, 309, 372, 427
TspDTI ATGAA 1 cut(s) 352
Van91I CCANNNNNTGG 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.