Rmu_sc0000283.1_g000004

FAR1 DNA-binding domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000283.1
Physical Location & Seq
Reverse (-)
14750 .. 15830
1081 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000283.1_g000004.1.cds

Sequence Viewer

Length: 738 bp
atggaaagcgagagtaacaacaacaacaacaacaacccatttgattcagatgagagccaaagttgtgagcttccaaatgacattgatttgtgctcaggtgaagtagataagattatagaactgtctaatggacgctcacatttgatgggtaatcccattgagccttacataggaatggagttcaagtctagagacactgctcgagagttttacattgcttatggcaggcacactgggtttacagttaggattcatcacaaccgtcgttcgaggatgaataacatggtgattggccaggatttcgtttgctcgaaagagggttttcgtgacaagaagtatgtgtacagggacaatagagttcttcctccaccgcctgtgacaagagaaggttgtgctgcaatgctgagggtggctttaagagatggggaaaagtgggttgttaccaagtttgtgaaggagcacaatcacacattgatgtctccgagtaaagttccgtggcgaggatctgggaaaaccttgatcaatgaggatgagaaggatcggaaaattagggagctgaccattgaactgagcaatgagagacagcgatgtaaacgtaagtgtgcagcatatcaagatcaattgaataggcttttgaaagatgtccaagaccacagtgatcacttgtcagaaagagttcaagacatagtgaagaacataagagaactagagagcgagcaatctgaggactcagattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

245

Amino Acids

28.5

Weight (kDa)

6.27

Isoelectric Point (pI)

52.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 371
AclWI GGATC 2 cut(s) 511, 546
AcoI YGGCCR 1 cut(s) 292
AfaI GTAC 1 cut(s) 344
AfiI CCNNNNNNNGG 2 cut(s) 170, 500
AgsI TTSAA 5 cut(s) 184, 566, 625, 637, 680
AjnI CCWGG 1 cut(s) 294
AluBI AGCT 2 cut(s) 70, 556
AluI AGCT 2 cut(s) 70, 556
Alw21I GWGCWC 2 cut(s) 95, 462
Alw26I GTCTC 3 cut(s) 186, 483, 574
AlwI GGATC 2 cut(s) 511, 546
Ama87I CYCGRG 1 cut(s) 201
AoxI GGCC 1 cut(s) 292
ApeKI GCWGC 2 cut(s) 395, 605
Asp700I GAANNNNTTC 1 cut(s) 675
AsuHPI GGTGA 2 cut(s) 110, 298
AvaI CYCGRG 1 cut(s) 201
BalI TGGCCA 1 cut(s) 294
BarI GAAGNNNNNNTAC 2 cut(s) 326, 358
Bbv12I GWGCWC 2 cut(s) 95, 462
BbvCI CCTCAGC 1 cut(s) 404
BbvI GCAGC 2 cut(s) 382, 617
BccI CCATC 2 cut(s) 139, 416
BciT130I CCWGG 1 cut(s) 296
BclI TGATCA 2 cut(s) 519, 658
BcoDI GTCTC 3 cut(s) 186, 483, 574
BfaI CTAG 2 cut(s) 189, 707
BisI GCNGC 2 cut(s) 396, 606
BlsI GCNGC 2 cut(s) 397, 607
Bme1390I CCNGG 1 cut(s) 296
BmeT110I CYCGRG 1 cut(s) 201
BmrFI CCNGG 1 cut(s) 296
BmrI ACTGGG 1 cut(s) 243
BmuI ACTGGG 1 cut(s) 243
Bpu10I CCTNAGC 2 cut(s) 94, 404
BsaJI CCNNGG 1 cut(s) 494
BsaXI ACNNNNNCTCC 2 cut(s) 170, 200
Bsc4I CCNNNNNNNGG 2 cut(s) 170, 500
Bse1I ACTGG 1 cut(s) 238
Bse3DI GCAATG 3 cut(s) 213, 405, 580
BseBI CCWGG 1 cut(s) 296
BseDI CCNNGG 1 cut(s) 494
BseGI GGATG 2 cut(s) 279, 535
BseLI CCNNNNNNNGG 2 cut(s) 170, 500
BseMI GCAATG 3 cut(s) 213, 405, 580
BseMII CTCAG 4 cut(s) 108, 395, 560, 714
BseNI ACTGG 1 cut(s) 238
BseXI GCAGC 2 cut(s) 382, 617
BsgI GTGCAG 1 cut(s) 624
BshFI GGCC 1 cut(s) 294
BsiHKAI GWGCWC 2 cut(s) 95, 462
BsiHKCI CYCGRG 1 cut(s) 201
BslFI GGGAC 1 cut(s) 362
BslI CCNNNNNNNGG 2 cut(s) 170, 500
BsmAI GTCTC 3 cut(s) 186, 483, 574
BsmFI GGGAC 1 cut(s) 362
BsnI GGCC 1 cut(s) 294
BsoBI CYCGRG 1 cut(s) 201
Bsp1286I GDGCHC 2 cut(s) 95, 462
Bsp1407I TGTACA 1 cut(s) 342
Bsp143I GATC 5 cut(s) 503, 519, 538, 616, 658
BspACI CCGC 1 cut(s) 371
BspANI GGCC 1 cut(s) 294
BspCNI CTCAG 4 cut(s) 107, 396, 561, 715
BspPI GGATC 2 cut(s) 511, 546
BsrDI GCAATG 3 cut(s) 213, 405, 580
BsrGI TGTACA 1 cut(s) 342
BsrI ACTGG 1 cut(s) 238
BssECI CCNNGG 1 cut(s) 494
BssMI GATC 5 cut(s) 503, 519, 538, 616, 658
Bst2UI CCWGG 1 cut(s) 296
Bst4CI ACNGT 4 cut(s) 123, 244, 263, 656
BstAUI TGTACA 1 cut(s) 342
BstC8I GCNNGC 2 cut(s) 227, 716
BstDEI CTNAG 5 cut(s) 94, 404, 569, 723, 730
BstDSI CCRYGG 1 cut(s) 494
BstENI CCTNNNNNAGG 1 cut(s) 168
BstF5I GGATG 2 cut(s) 279, 535
BstKTI GATC 5 cut(s) 506, 522, 541, 619, 661
BstMAI GTCTC 3 cut(s) 186, 483, 574
BstMBI GATC 5 cut(s) 503, 519, 538, 616, 658
BstNI CCWGG 1 cut(s) 296
BstSCI CCNGG 1 cut(s) 294
BstV1I GCAGC 2 cut(s) 382, 617
BstX2I RGATCY 1 cut(s) 503
BstYI RGATCY 1 cut(s) 503
BsuRI GGCC 1 cut(s) 294
BtgI CCRYGG 1 cut(s) 494
BtgZI GCGATG 1 cut(s) 601
BtsCI GGATG 2 cut(s) 279, 535
BtsI GCAGTG 1 cut(s) 195
BtsIMutI CAGTG 3 cut(s) 195, 231, 661
Cac8I GCNNGC 2 cut(s) 227, 716
CseI GACGC 1 cut(s) 141
Csp6I GTAC 1 cut(s) 343
CviAII CATG 1 cut(s) 283
CviJI RGCY 7 cut(s) 57, 70, 163, 294, 413, 556, 631
CviKI_1 RGCY 7 cut(s) 57, 70, 163, 294, 413, 556, 631
CviQI GTAC 1 cut(s) 343
DdeI CTNAG 5 cut(s) 94, 404, 569, 723, 730
DpnI GATC 5 cut(s) 505, 521, 540, 618, 660
DpnII GATC 5 cut(s) 503, 519, 538, 616, 658
EaeI YGGCCR 1 cut(s) 292
Eco88I CYCGRG 1 cut(s) 201
EcoNI CCTNNNNNAGG 1 cut(s) 168
EcoRII CCWGG 1 cut(s) 294
FaeI CATG 1 cut(s) 286
FaiI YATR 8 cut(s) 116, 170, 222, 284, 339, 610, 686, 698
FaqI GGGAC 1 cut(s) 362
FatI CATG 1 cut(s) 282
FbaI TGATCA 2 cut(s) 519, 658
Fnu4HI GCNGC 2 cut(s) 396, 606
FokI GGATG 2 cut(s) 286, 542
Fsp4HI GCNGC 2 cut(s) 396, 606
FspBI CTAG 2 cut(s) 189, 707
GluI GCNGC 2 cut(s) 396, 606
HaeIII GGCC 1 cut(s) 294
HgaI GACGC 1 cut(s) 141
Hin1II CATG 1 cut(s) 286
HinfI GANTC 3 cut(s) 44, 250, 728
HphI GGTGA 2 cut(s) 110, 298
Hpy166II GTNNAC 3 cut(s) 240, 343, 593
Hpy188I TCNGA 6 cut(s) 49, 483, 543, 670, 724, 733
Hpy188III TCNNGA 5 cut(s) 189, 203, 326, 614, 680
Hpy8I GTNNAC 3 cut(s) 240, 343, 593
Hpy99I CGWCG 1 cut(s) 267
HpyAV CCTTC 3 cut(s) 380, 448, 529
HpyCH4III ACNGT 4 cut(s) 123, 244, 263, 656
HpyCH4IV ACGT 1 cut(s) 595
HpyCH4V TGCA 2 cut(s) 398, 605
HpyF3I CTNAG 5 cut(s) 94, 404, 569, 723, 730
HpySE526I ACGT 1 cut(s) 595
Hsp92II CATG 1 cut(s) 286
Ksp22I TGATCA 2 cut(s) 519, 658
Kzo9I GATC 5 cut(s) 503, 519, 538, 616, 658
LmnI GCTCC 2 cut(s) 457, 553
LpnPI CCDG 8 cut(s) 81, 211, 219, 281, 308, 331, 387, 492
Lsp1109I GCAGC 2 cut(s) 382, 617
MaeI CTAG 2 cut(s) 189, 707
MaeII ACGT 1 cut(s) 595
MaeIII GTNAC 4 cut(s) 14, 326, 376, 439
MalI GATC 5 cut(s) 505, 521, 540, 618, 660
MboI GATC 5 cut(s) 503, 519, 538, 616, 658
MboII GAAGA 2 cut(s) 353, 703
MfeI CAATTG 1 cut(s) 620
MflI RGATCY 1 cut(s) 503
MhlI GDGCHC 2 cut(s) 95, 462
MlsI TGGCCA 1 cut(s) 294
MluCI AATT 2 cut(s) 546, 620
MluNI TGGCCA 1 cut(s) 294
MlyI GAGTC 1 cut(s) 722
MnlI CCTC 7 cut(s) 264, 310, 375, 399, 494, 520, 718
Mox20I TGGCCA 1 cut(s) 294
MroXI GAANNNNTTC 1 cut(s) 675
MscI TGGCCA 1 cut(s) 294
MseI TTAA 2 cut(s) 416, 736
MslI CAYNNNNRTG 2 cut(s) 173, 473
Msp20I TGGCCA 1 cut(s) 294
MspR9I CCNGG 1 cut(s) 296
MunI CAATTG 1 cut(s) 620
MvaI CCWGG 1 cut(s) 296
NdeII GATC 5 cut(s) 503, 519, 538, 616, 658
NlaIII CATG 1 cut(s) 286
NmuCI GTSAC 2 cut(s) 326, 376
PaeR7I CTCGAG 1 cut(s) 201
PdmI GAANNNNTTC 1 cut(s) 675
PfeI GAWTC 2 cut(s) 44, 250
PkrI GCNGC 2 cut(s) 397, 607
PleI GAGTC 1 cut(s) 722
PpsI GAGTC 1 cut(s) 722
Psp6I CCWGG 1 cut(s) 294
PspGI CCWGG 1 cut(s) 294
PsuI RGATCY 1 cut(s) 503
RsaI GTAC 1 cut(s) 344
RsaNI GTAC 1 cut(s) 343
RseI CAYNNNNRTG 2 cut(s) 173, 473
SaqAI TTAA 2 cut(s) 416, 736
SatI GCNGC 2 cut(s) 396, 606
Sau3AI GATC 5 cut(s) 503, 519, 538, 616, 658
SchI GAGTC 1 cut(s) 722
ScrFI CCNGG 1 cut(s) 296
SduI GDGCHC 2 cut(s) 95, 462
SetI ASST 6 cut(s) 72, 100, 391, 518, 558, 598
Sfr274I CTCGAG 1 cut(s) 201
SlaI CTCGAG 1 cut(s) 201
SmiMI CAYNNNNRTG 2 cut(s) 173, 473
SmlI CTYRAG 1 cut(s) 201
SmoI CTYRAG 1 cut(s) 201
Sse9I AATT 2 cut(s) 546, 620
SsiI CCGC 1 cut(s) 371
SspMI CTAG 2 cut(s) 189, 707
StyD4I CCNGG 1 cut(s) 294
TaaI ACNGT 4 cut(s) 123, 244, 263, 656
TaiI ACGT 1 cut(s) 598
TaqI TCGA 3 cut(s) 202, 269, 311
TasI AATT 2 cut(s) 546, 620
TatI WGTACW 1 cut(s) 342
TfiI GAWTC 2 cut(s) 44, 250
Tru1I TTAA 2 cut(s) 416, 736
Tru9I TTAA 2 cut(s) 416, 736
TscAI CASTG 3 cut(s) 202, 238, 661
TseFI GTSAC 2 cut(s) 326, 376
TseI GCWGC 2 cut(s) 395, 605
Tsp45I GTSAC 2 cut(s) 326, 376
TspDTI ATGAA 2 cut(s) 242, 290
TspGWI ACGGA 1 cut(s) 483
TspRI CASTG 3 cut(s) 202, 238, 661
XagI CCTNNNNNAGG 1 cut(s) 168
XbaI TCTAGA 1 cut(s) 188
XhoI CTCGAG 1 cut(s) 201
XmnI GAANNNNTTC 1 cut(s) 675
XspI CTAG 2 cut(s) 189, 707
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.