RchiOBHm_Chr5g0004771

Phosphatidylinositol phosphatidylcholine transfer protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
3137950 .. 3139074
1125 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 138 bp
ATGGGTATTCCTAATCCAGTTGTGATCAAGCAGTTTCAATTGATAATGGAGGAAGTTGATAAGCTGCTGAAGAACACATTTGAGGTTAGACCCTATTTCTCTTTCAAGTTTGCTCGATCTGGGCTCTTAAAGTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

45

Amino Acids

5.32

Weight (kDa)

9.7

Isoelectric Point (pI)

20.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 89
AgsI TTSAA 2 cut(s) 38, 106
AluBI AGCT 1 cut(s) 64
AluI AGCT 1 cut(s) 64
ApeKI GCWGC 1 cut(s) 64
BanII GRGCYC 1 cut(s) 126
BbvI GCAGC 1 cut(s) 51
BclI TGATCA 1 cut(s) 24
BisI GCNGC 1 cut(s) 65
BlsI GCNGC 1 cut(s) 66
Bse1I ACTGG 1 cut(s) 17
BseNI ACTGG 1 cut(s) 17
BseXI GCAGC 1 cut(s) 51
Bsp1286I GDGCHC 1 cut(s) 126
Bsp143I GATC 2 cut(s) 24, 116
BsrI ACTGG 1 cut(s) 17
BssMI GATC 2 cut(s) 24, 116
BstKTI GATC 2 cut(s) 27, 119
BstMBI GATC 2 cut(s) 24, 116
BstV1I GCAGC 1 cut(s) 51
CviJI RGCY 2 cut(s) 64, 124
CviKI_1 RGCY 2 cut(s) 64, 124
DpnI GATC 2 cut(s) 26, 118
DpnII GATC 2 cut(s) 24, 116
Eco24I GRGCYC 1 cut(s) 126
Eco57I CTGAAG 1 cut(s) 89
EcoT38I GRGCYC 1 cut(s) 126
FbaI TGATCA 1 cut(s) 24
Fnu4HI GCNGC 1 cut(s) 65
FriOI GRGCYC 1 cut(s) 126
Fsp4HI GCNGC 1 cut(s) 65
FspEI CC 9 cut(s) 24, 30, 32, 35, 68, 105, 105, 106, 106
GluI GCNGC 1 cut(s) 65
Ksp22I TGATCA 1 cut(s) 24
Kzo9I GATC 2 cut(s) 24, 116
LpnPI CCDG 2 cut(s) 30, 105
Lsp1109I GCAGC 1 cut(s) 51
MalI GATC 2 cut(s) 26, 118
MboI GATC 2 cut(s) 24, 116
MboII GAAGA 1 cut(s) 82
MfeI CAATTG 1 cut(s) 38
MhlI GDGCHC 1 cut(s) 126
MluCI AATT 1 cut(s) 38
MnlI CCTC 2 cut(s) 43, 76
MseI TTAA 1 cut(s) 128
MunI CAATTG 1 cut(s) 38
NdeII GATC 2 cut(s) 24, 116
PkrI GCNGC 1 cut(s) 66
SaqAI TTAA 1 cut(s) 128
SatI GCNGC 1 cut(s) 65
Sau3AI GATC 2 cut(s) 24, 116
SduI GDGCHC 1 cut(s) 126
SetI ASST 2 cut(s) 66, 87
SgeI CNNG 5 cut(s) 29, 40, 118, 126, 132
Sse9I AATT 1 cut(s) 38
TaqI TCGA 1 cut(s) 115
TasI AATT 1 cut(s) 38
Tru1I TTAA 1 cut(s) 128
Tru9I TTAA 1 cut(s) 128
TseI GCWGC 1 cut(s) 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.