RchiOBHm_Chr2g0145841

Phosphatidylinositol phosphatidylcholine transfer protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
63597178 .. 63598855
1678 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51567

Sequence Viewer

Length: 138 bp
ATGGGTATTCCTAATCCAGAAGCGATCAAGCAGTTTCAATTGACAATGGAGGAAGTTGATGAGCTGCTGAAGAACACATTTGAGTTGCTGCTACTACAGAAGGAAGGGAAGAGCAAGTATATGTGCCAGATGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

45

Amino Acids

5.29

Weight (kDa)

5.19

Isoelectric Point (pI)

28.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 89
AgsI TTSAA 1 cut(s) 38
AluBI AGCT 1 cut(s) 64
AluI AGCT 1 cut(s) 64
ApeKI GCWGC 2 cut(s) 64, 88
BbvI GCAGC 2 cut(s) 51, 75
BfmI CTRYAG 1 cut(s) 95
BisI GCNGC 2 cut(s) 65, 89
BlsI GCNGC 2 cut(s) 66, 90
BseXI GCAGC 2 cut(s) 51, 75
Bsp143I GATC 1 cut(s) 24
BspQI GCTCTTC 1 cut(s) 104
BssMI GATC 1 cut(s) 24
Bst6I CTCTTC 1 cut(s) 104
BstKTI GATC 1 cut(s) 27
BstMBI GATC 1 cut(s) 24
BstSFI CTRYAG 1 cut(s) 95
BstV1I GCAGC 2 cut(s) 51, 75
CviJI RGCY 1 cut(s) 64
CviKI_1 RGCY 1 cut(s) 64
DpnI GATC 1 cut(s) 26
DpnII GATC 1 cut(s) 24
Eam1104I CTCTTC 1 cut(s) 104
EarI CTCTTC 1 cut(s) 104
Eco57I CTGAAG 1 cut(s) 89
FaiI YATR 2 cut(s) 120, 122
Fnu4HI GCNGC 2 cut(s) 65, 89
Fsp4HI GCNGC 2 cut(s) 65, 89
FspEI CC 7 cut(s) 24, 30, 32, 35, 86, 90, 91
GluI GCNGC 2 cut(s) 65, 89
Hpy188III TCNNGA 1 cut(s) 17
HpyAV CCTTC 2 cut(s) 94, 98
Kzo9I GATC 1 cut(s) 24
LguI GCTCTTC 1 cut(s) 104
LpnPI CCDG 1 cut(s) 30
Lsp1109I GCAGC 2 cut(s) 51, 75
MalI GATC 1 cut(s) 26
MboI GATC 1 cut(s) 24
MboII GAAGA 2 cut(s) 82, 121
MfeI CAATTG 1 cut(s) 38
MluCI AATT 1 cut(s) 38
MnlI CCTC 1 cut(s) 43
MunI CAATTG 1 cut(s) 38
NdeII GATC 1 cut(s) 24
PciSI GCTCTTC 1 cut(s) 104
PkrI GCNGC 2 cut(s) 66, 90
SapI GCTCTTC 1 cut(s) 104
SatI GCNGC 2 cut(s) 65, 89
Sau3AI GATC 1 cut(s) 24
SetI ASST 1 cut(s) 66
SfcI CTRYAG 1 cut(s) 95
SgeI CNNG 3 cut(s) 29, 40, 127
Sse9I AATT 1 cut(s) 38
TasI AATT 1 cut(s) 38
TseI GCWGC 2 cut(s) 64, 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.