Rroxscaffold_2G00154730

Phosphatidylinositol phosphatidylcholine transfer protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
91234474 .. 91236336
1863 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00154730.1

Sequence Viewer

Length: 195 bp
ATGTTTAAGTATCTGCAAAGGGAACTGACAGAAAAGAAGATGGGTATTCCTAATCCAGAAGCGATCAAGCAGTTTCAATTGACAATGGAGGAAGTTGATGAGCTGCTGAAGAACACATTTGAGGTTTACAACCATAAACCTGAGTCTCTGAAAGCGGCCTTCCCTAGAGTTGACAAGTTGCAAACCCTAATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.61

Weight (kDa)

6.57

Isoelectric Point (pI)

32.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 155
AcuI CTGAAG 1 cut(s) 128
AgsI TTSAA 1 cut(s) 77
AluBI AGCT 1 cut(s) 103
AluI AGCT 1 cut(s) 103
Alw26I GTCTC 1 cut(s) 150
AoxI GGCC 1 cut(s) 156
ApeKI GCWGC 1 cut(s) 103
BbvI GCAGC 1 cut(s) 90
BccI CCATC 1 cut(s) 34
BcoDI GTCTC 1 cut(s) 150
BfaI CTAG 1 cut(s) 165
BisI GCNGC 2 cut(s) 104, 156
BlsI GCNGC 2 cut(s) 105, 157
BseMII CTCAG 1 cut(s) 132
BseXI GCAGC 1 cut(s) 90
BshFI GGCC 1 cut(s) 158
BsmAI GTCTC 1 cut(s) 150
BsnI GGCC 1 cut(s) 158
Bsp143I GATC 1 cut(s) 63
BspACI CCGC 1 cut(s) 155
BspANI GGCC 1 cut(s) 158
BspCNI CTCAG 1 cut(s) 133
BssMI GATC 1 cut(s) 63
BstDEI CTNAG 1 cut(s) 141
BstKTI GATC 1 cut(s) 66
BstMAI GTCTC 1 cut(s) 150
BstMBI GATC 1 cut(s) 63
BstV1I GCAGC 1 cut(s) 90
BsuRI GGCC 1 cut(s) 158
CviJI RGCY 2 cut(s) 103, 158
CviKI_1 RGCY 2 cut(s) 103, 158
DdeI CTNAG 1 cut(s) 141
DpnI GATC 1 cut(s) 65
DpnII GATC 1 cut(s) 63
Eco57I CTGAAG 1 cut(s) 128
FaiI YATR 2 cut(s) 135, 193
Fnu4HI GCNGC 2 cut(s) 104, 156
Fsp4HI GCNGC 2 cut(s) 104, 156
FspBI CTAG 1 cut(s) 165
GluI GCNGC 2 cut(s) 104, 156
HaeIII GGCC 1 cut(s) 158
HincII GTYRAC 1 cut(s) 172
HindII GTYRAC 1 cut(s) 172
HinfI GANTC 1 cut(s) 143
Hpy166II GTNNAC 2 cut(s) 127, 172
Hpy188I TCNGA 1 cut(s) 150
Hpy188III TCNNGA 1 cut(s) 56
Hpy8I GTNNAC 2 cut(s) 127, 172
HpyAV CCTTC 1 cut(s) 169
HpyCH4V TGCA 2 cut(s) 16, 181
HpyF3I CTNAG 1 cut(s) 141
Kzo9I GATC 1 cut(s) 63
LpnPI CCDG 2 cut(s) 69, 153
Lsp1109I GCAGC 1 cut(s) 90
MaeI CTAG 1 cut(s) 165
MalI GATC 1 cut(s) 65
MboI GATC 1 cut(s) 63
MboII GAAGA 2 cut(s) 49, 121
MfeI CAATTG 1 cut(s) 77
MluCI AATT 1 cut(s) 77
MlyI GAGTC 1 cut(s) 152
MnlI CCTC 2 cut(s) 82, 115
MseI TTAA 1 cut(s) 6
MunI CAATTG 1 cut(s) 77
NdeII GATC 1 cut(s) 63
PkrI GCNGC 2 cut(s) 105, 157
PleI GAGTC 1 cut(s) 151
PpsI GAGTC 1 cut(s) 151
SaqAI TTAA 1 cut(s) 6
SatI GCNGC 2 cut(s) 104, 156
Sau3AI GATC 1 cut(s) 63
SchI GAGTC 1 cut(s) 152
SetI ASST 3 cut(s) 105, 126, 142
SgeI CNNG 5 cut(s) 68, 79, 152, 177, 187
Sse9I AATT 1 cut(s) 77
SsiI CCGC 1 cut(s) 155
SspMI CTAG 1 cut(s) 165
TasI AATT 1 cut(s) 77
TauI GCSGC 1 cut(s) 158
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
TseI GCWGC 1 cut(s) 103
XspI CTAG 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.