RchiOBHm_Chr2g0130661

Phosphatidylinositol phosphatidylcholine transfer protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
46741700 .. 46743464
1765 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50210

Sequence Viewer

Length: 189 bp
ATGAAGAATTGGGAACTGACAGAAAAGAAGATGGGTATTCCTAATCCAGAAGCGATCAAGCAGTTTCAATTGACAATGGAGGAAGTTGATGAGCTGCTGAAGAACACATTTGAGTTGCTGCTACTACAGAAGGAAGGGAAGAGCAAGTATATGTGCCAGATGAAAGGACCGCATTCTCAAGCAAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

7.24

Weight (kDa)

6.56

Isoelectric Point (pI)

31.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 170
AcuI CTGAAG 1 cut(s) 119
AgsI TTSAA 1 cut(s) 68
AluBI AGCT 2 cut(s) 94, 186
AluI AGCT 2 cut(s) 94, 186
ApeKI GCWGC 2 cut(s) 94, 118
AspS9I GGNCC 1 cut(s) 167
AvaII GGWCC 1 cut(s) 167
BbvI GCAGC 2 cut(s) 81, 105
BccI CCATC 1 cut(s) 25
BfaI CTAG 1 cut(s) 187
BfmI CTRYAG 1 cut(s) 125
BisI GCNGC 2 cut(s) 95, 119
BlsI GCNGC 2 cut(s) 96, 120
Bme18I GGWCC 1 cut(s) 167
BmgT120I GGNCC 1 cut(s) 167
BpuEI CTTGAG 1 cut(s) 162
BseXI GCAGC 2 cut(s) 81, 105
BsmI GAATGC 1 cut(s) 172
Bsp143I GATC 1 cut(s) 54
BspACI CCGC 1 cut(s) 170
BspQI GCTCTTC 1 cut(s) 134
BssMI GATC 1 cut(s) 54
Bst6I CTCTTC 1 cut(s) 134
BstC8I GCNNGC 1 cut(s) 184
BstKTI GATC 1 cut(s) 57
BstMBI GATC 1 cut(s) 54
BstSFI CTRYAG 1 cut(s) 125
BstV1I GCAGC 2 cut(s) 81, 105
Cac8I GCNNGC 1 cut(s) 184
Cfr13I GGNCC 1 cut(s) 167
CviJI RGCY 2 cut(s) 94, 186
CviKI_1 RGCY 2 cut(s) 94, 186
DpnI GATC 1 cut(s) 56
DpnII GATC 1 cut(s) 54
Eam1104I CTCTTC 1 cut(s) 134
EarI CTCTTC 1 cut(s) 134
Eco47I GGWCC 1 cut(s) 167
Eco57I CTGAAG 1 cut(s) 119
FaiI YATR 2 cut(s) 150, 152
Fnu4HI GCNGC 2 cut(s) 95, 119
Fsp4HI GCNGC 2 cut(s) 95, 119
FspBI CTAG 1 cut(s) 187
GluI GCNGC 2 cut(s) 95, 119
Hpy188III TCNNGA 1 cut(s) 47
HpyAV CCTTC 2 cut(s) 124, 128
Kzo9I GATC 1 cut(s) 54
LguI GCTCTTC 1 cut(s) 134
LpnPI CCDG 2 cut(s) 60, 170
Lsp1109I GCAGC 2 cut(s) 81, 105
MaeI CTAG 1 cut(s) 187
MalI GATC 1 cut(s) 56
MboI GATC 1 cut(s) 54
MboII GAAGA 4 cut(s) 16, 40, 112, 151
MfeI CAATTG 1 cut(s) 68
MluCI AATT 2 cut(s) 7, 68
MnlI CCTC 1 cut(s) 73
MunI CAATTG 1 cut(s) 68
Mva1269I GAATGC 1 cut(s) 172
NdeII GATC 1 cut(s) 54
PciSI GCTCTTC 1 cut(s) 134
PctI GAATGC 1 cut(s) 172
PkrI GCNGC 2 cut(s) 96, 120
PspPI GGNCC 1 cut(s) 167
SapI GCTCTTC 1 cut(s) 134
SatI GCNGC 2 cut(s) 95, 119
Sau3AI GATC 1 cut(s) 54
Sau96I GGNCC 1 cut(s) 167
SetI ASST 2 cut(s) 96, 188
SfcI CTRYAG 1 cut(s) 125
SgeI CNNG 4 cut(s) 59, 70, 157, 169
SinI GGWCC 1 cut(s) 167
SmlI CTYRAG 1 cut(s) 177
SmoI CTYRAG 1 cut(s) 177
Sse9I AATT 2 cut(s) 7, 68
SsiI CCGC 1 cut(s) 170
SspMI CTAG 1 cut(s) 187
TasI AATT 2 cut(s) 7, 68
TseI GCWGC 2 cut(s) 94, 118
TspDTI ATGAA 2 cut(s) 17, 176
VpaK11BI GGWCC 1 cut(s) 167
XspI CTAG 1 cut(s) 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.