RchiOBHm_Chr3g0469501

Phosphatidylinositol phosphatidylcholine transfer protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
15290337 .. 15292069
1733 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ43533

Sequence Viewer

Length: 129 bp
ATGAAGAATTGGGAACTGACAGAAAAGAAGATGGGTATTCCTAATCCAGAAGCGATCAAGCAGTTTCAATTGACAATGGAGGAAGTTGATGAGCTGCTGAAGAACACATTTGAGTTGCTGCTACTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

42

Amino Acids

5.01

Weight (kDa)

4.64

Isoelectric Point (pI)

25.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 119
AgsI TTSAA 1 cut(s) 68
AluBI AGCT 1 cut(s) 94
AluI AGCT 1 cut(s) 94
ApeKI GCWGC 2 cut(s) 94, 118
BbvI GCAGC 2 cut(s) 81, 105
BccI CCATC 1 cut(s) 25
BfmI CTRYAG 1 cut(s) 125
BisI GCNGC 2 cut(s) 95, 119
BlsI GCNGC 2 cut(s) 96, 120
BseXI GCAGC 2 cut(s) 81, 105
Bsp143I GATC 1 cut(s) 54
BssMI GATC 1 cut(s) 54
BstKTI GATC 1 cut(s) 57
BstMBI GATC 1 cut(s) 54
BstSFI CTRYAG 1 cut(s) 125
BstV1I GCAGC 2 cut(s) 81, 105
CviJI RGCY 1 cut(s) 94
CviKI_1 RGCY 1 cut(s) 94
DpnI GATC 1 cut(s) 56
DpnII GATC 1 cut(s) 54
Eco57I CTGAAG 1 cut(s) 119
FaiI YATR 1 cut(s) 127
Fnu4HI GCNGC 2 cut(s) 95, 119
Fsp4HI GCNGC 2 cut(s) 95, 119
FspEI CC 6 cut(s) 17, 18, 54, 60, 62, 65
GluI GCNGC 2 cut(s) 95, 119
Hpy188III TCNNGA 1 cut(s) 47
Kzo9I GATC 1 cut(s) 54
LpnPI CCDG 1 cut(s) 60
Lsp1109I GCAGC 2 cut(s) 81, 105
MalI GATC 1 cut(s) 56
MboI GATC 1 cut(s) 54
MboII GAAGA 3 cut(s) 16, 40, 112
MfeI CAATTG 1 cut(s) 68
MluCI AATT 2 cut(s) 7, 68
MnlI CCTC 1 cut(s) 73
MunI CAATTG 1 cut(s) 68
NdeII GATC 1 cut(s) 54
PkrI GCNGC 2 cut(s) 96, 120
SatI GCNGC 2 cut(s) 95, 119
Sau3AI GATC 1 cut(s) 54
SetI ASST 1 cut(s) 96
SfcI CTRYAG 1 cut(s) 125
SgeI CNNG 2 cut(s) 59, 70
Sse9I AATT 2 cut(s) 7, 68
TasI AATT 2 cut(s) 7, 68
TseI GCWGC 2 cut(s) 94, 118
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.