Rh5AG262200

Phosphatidylinositol phosphatidylcholine transfer protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
34410735 .. 34430848
20114 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG262200.1

Sequence Viewer

Length: 285 bp
ATGACGATGGGATGCCTAGTGCTAAATCCAATATTGGGAGCTTCGATTGATGAGGAACTAAGGAGGACTGCATGCAGCAGCAGGTCATTGAGACTAGTGTGTCGGCAGAAATGGTACAAGTCTTTCTTTATGTTTAAATATCTTCCAAGGGAACTGACAGAAAAGAAGATGGGTATTCCTTATCCAGTAGTGATCAAGCAGTTTCAATTGACAATGGAGGAAGGCTTTGTAGGAAGTGCAATGAAACATTCAGAAGACTGGAGGGGAAAGATCAGAAATGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

94

Amino Acids

10.98

Weight (kDa)

9.67

Isoelectric Point (pI)

55.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 99
Acc36I ACCTGC 1 cut(s) 72
AfaI GTAC 1 cut(s) 116
AfiI CCNNNNNNNGG 1 cut(s) 35
AgsI TTSAA 1 cut(s) 206
AhlI ACTAGT 1 cut(s) 94
AluBI AGCT 1 cut(s) 41
AluI AGCT 1 cut(s) 41
Alw26I GTCTC 1 cut(s) 85
ApeKI GCWGC 2 cut(s) 75, 78
BbsI GAAGAC 1 cut(s) 261
BbvI GCAGC 2 cut(s) 87, 90
BccI CCATC 1 cut(s) 163
BclI TGATCA 1 cut(s) 192
BcoDI GTCTC 1 cut(s) 85
BcuI ACTAGT 1 cut(s) 94
BfaI CTAG 2 cut(s) 17, 95
BfuAI ACCTGC 1 cut(s) 72
BisI GCNGC 2 cut(s) 76, 79
BlsI GCNGC 2 cut(s) 77, 80
BmsI GCATC 1 cut(s) 2
BpiI GAAGAC 1 cut(s) 261
BpmI CTGGAG 1 cut(s) 280
BsaJI CCNNGG 1 cut(s) 146
Bsc4I CCNNNNNNNGG 1 cut(s) 35
Bse1I ACTGG 2 cut(s) 185, 263
Bse3DI GCAATG 1 cut(s) 246
BseDI CCNNGG 1 cut(s) 146
BseGI GGATG 1 cut(s) 17
BseLI CCNNNNNNNGG 1 cut(s) 35
BseMI GCAATG 1 cut(s) 246
BseNI ACTGG 2 cut(s) 185, 263
BseXI GCAGC 2 cut(s) 87, 90
BslI CCNNNNNNNGG 1 cut(s) 35
BsmAI GTCTC 1 cut(s) 85
Bsp143I GATC 2 cut(s) 192, 270
BspMI ACCTGC 1 cut(s) 72
BsrDI GCAATG 1 cut(s) 246
BsrI ACTGG 2 cut(s) 185, 263
BssECI CCNNGG 1 cut(s) 146
BssMI GATC 2 cut(s) 192, 270
BssT1I CCWWGG 1 cut(s) 146
BstC8I GCNNGC 1 cut(s) 73
BstDEI CTNAG 1 cut(s) 59
BstF5I GGATG 1 cut(s) 17
BstKTI GATC 2 cut(s) 195, 273
BstMAI GTCTC 1 cut(s) 85
BstMBI GATC 2 cut(s) 192, 270
BstNSI RCATGY 1 cut(s) 75
BstV1I GCAGC 2 cut(s) 87, 90
BstV2I GAAGAC 1 cut(s) 261
BtsCI GGATG 1 cut(s) 17
BveI ACCTGC 1 cut(s) 72
Cac8I GCNNGC 1 cut(s) 73
Csp6I GTAC 1 cut(s) 115
CviAII CATG 1 cut(s) 72
CviJI RGCY 2 cut(s) 41, 225
CviKI_1 RGCY 2 cut(s) 41, 225
CviQI GTAC 1 cut(s) 115
DdeI CTNAG 1 cut(s) 59
DpnI GATC 2 cut(s) 194, 272
DpnII GATC 2 cut(s) 192, 270
DraI TTTAAA 1 cut(s) 136
DrdI GACNNNNNNGTC 1 cut(s) 99
DseDI GACNNNNNNGTC 1 cut(s) 99
Eco130I CCWWGG 1 cut(s) 146
EcoT14I CCWWGG 1 cut(s) 146
ErhI CCWWGG 1 cut(s) 146
FaeI CATG 1 cut(s) 75
FaiI YATR 2 cut(s) 73, 131
FalI AAGNNNNNCTT 2 cut(s) 110, 142
FatI CATG 1 cut(s) 71
FbaI TGATCA 1 cut(s) 192
Fnu4HI GCNGC 2 cut(s) 76, 79
FokI GGATG 1 cut(s) 24
Fsp4HI GCNGC 2 cut(s) 76, 79
FspBI CTAG 2 cut(s) 17, 95
GluI GCNGC 2 cut(s) 76, 79
GsuI CTGGAG 1 cut(s) 280
Hin1II CATG 1 cut(s) 75
Hpy188I TCNGA 2 cut(s) 253, 275
HpyAV CCTTC 1 cut(s) 215
HpyCH4V TGCA 3 cut(s) 71, 75, 239
HpyF3I CTNAG 1 cut(s) 59
Hsp92II CATG 1 cut(s) 75
Ksp22I TGATCA 1 cut(s) 192
Kzo9I GATC 2 cut(s) 192, 270
LmnI GCTCC 1 cut(s) 38
LpnPI CCDG 3 cut(s) 67, 198, 244
Lsp1109I GCAGC 2 cut(s) 87, 90
LweI GCATC 1 cut(s) 2
MaeI CTAG 2 cut(s) 17, 95
MalI GATC 2 cut(s) 194, 272
MboI GATC 2 cut(s) 192, 270
MboII GAAGA 3 cut(s) 134, 178, 266
MfeI CAATTG 1 cut(s) 206
MluCI AATT 1 cut(s) 206
MnlI CCTC 4 cut(s) 46, 57, 211, 255
MseI TTAA 2 cut(s) 135, 283
MunI CAATTG 1 cut(s) 206
NdeII GATC 2 cut(s) 192, 270
NlaIII CATG 1 cut(s) 75
NspI RCATGY 1 cut(s) 75
PaeI GCATGC 1 cut(s) 75
PkrI GCNGC 2 cut(s) 77, 80
RsaI GTAC 1 cut(s) 116
RsaNI GTAC 1 cut(s) 115
SaqAI TTAA 2 cut(s) 135, 283
SatI GCNGC 2 cut(s) 76, 79
Sau3AI GATC 2 cut(s) 192, 270
SetI ASST 2 cut(s) 43, 86
SfaNI GCATC 1 cut(s) 2
SgeI CNNG 9 cut(s) 29, 84, 94, 107, 130, 159, 197, 208, 271
SpeI ACTAGT 1 cut(s) 94
SphI GCATGC 1 cut(s) 75
Sse9I AATT 1 cut(s) 206
SspI AATATT 1 cut(s) 33
SspMI CTAG 2 cut(s) 17, 95
StyI CCWWGG 1 cut(s) 146
TaqI TCGA 1 cut(s) 44
TasI AATT 1 cut(s) 206
Tru1I TTAA 2 cut(s) 135, 283
Tru9I TTAA 2 cut(s) 135, 283
TseI GCWGC 2 cut(s) 75, 78
TspDTI ATGAA 1 cut(s) 257
XceI RCATGY 1 cut(s) 75
XspI CTAG 2 cut(s) 17, 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.