RchiOBHm_Chr5g0041781

ubiquitin-protein transferase activity

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
36668626 .. 36668814
189 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 189 bp
ATGAGGACTTTGCACATGCAAGGTGGTGCTGATGAGCTGATTACTCAATTGCCTTACGCTCACCAATATCATGTAGATTGCATTATCAAGTGGCTGCAGATGAGTCACATGTGTCCTTTGTGTCGATACCCAATGCCAAGCGTGGAAAAGGGCCAGCTGCCTTCAAATTCCTTATGGAGGCTAGGCTAG

Protein Analysis

62

Amino Acids

7.21

Weight (kDa)

7.79

Isoelectric Point (pI)

43.84

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-RING_2 PF13639 16 - 42 1.1e-07 Ring finger domain
zf-rbx1 PF12678 20 - 42 5.4e-08 RING-H2 zinc finger domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 166
AfiI CCNNNNNNNGG 1 cut(s) 177
AflIII ACRYGT 1 cut(s) 108
AgsI TTSAA 1 cut(s) 165
AluBI AGCT 2 cut(s) 37, 157
AluI AGCT 2 cut(s) 37, 157
AoxI GGCC 1 cut(s) 151
ApeKI GCWGC 2 cut(s) 94, 157
ApoI RAATTY 1 cut(s) 166
AspS9I GGNCC 1 cut(s) 151
AsuHPI GGTGA 1 cut(s) 53
BbvI GCAGC 2 cut(s) 81, 144
BfaI CTAG 2 cut(s) 182, 187
BfmI CTRYAG 1 cut(s) 95
BisI GCNGC 2 cut(s) 95, 158
BlsI GCNGC 2 cut(s) 96, 159
BmgT120I GGNCC 1 cut(s) 151
Bsc4I CCNNNNNNNGG 1 cut(s) 177
BseLI CCNNNNNNNGG 1 cut(s) 177
BseXI GCAGC 2 cut(s) 81, 144
BshFI GGCC 1 cut(s) 153
BslI CCNNNNNNNGG 1 cut(s) 177
BsnI GGCC 1 cut(s) 153
BspANI GGCC 1 cut(s) 153
BspMAI CTGCAG 1 cut(s) 99
BstC8I GCNNGC 1 cut(s) 155
BstENI CCTNNNNNAGG 1 cut(s) 175
BstNSI RCATGY 2 cut(s) 19, 112
BstSFI CTRYAG 1 cut(s) 95
BstV1I GCAGC 2 cut(s) 81, 144
BsuRI GGCC 1 cut(s) 153
Cac8I GCNNGC 1 cut(s) 155
Cfr13I GGNCC 1 cut(s) 151
CviAII CATG 3 cut(s) 16, 71, 109
CviJI RGCY 6 cut(s) 37, 94, 153, 157, 181, 186
CviKI_1 RGCY 6 cut(s) 37, 94, 153, 157, 181, 186
EcoNI CCTNNNNNAGG 1 cut(s) 175
FaeI CATG 3 cut(s) 19, 74, 112
FaiI YATR 4 cut(s) 17, 72, 110, 175
FatI CATG 3 cut(s) 15, 70, 108
Fnu4HI GCNGC 2 cut(s) 95, 158
Fsp4HI GCNGC 2 cut(s) 95, 158
FspBI CTAG 2 cut(s) 182, 187
GluI GCNGC 2 cut(s) 95, 158
HaeIII GGCC 1 cut(s) 153
Hin1II CATG 3 cut(s) 19, 74, 112
HinfI GANTC 1 cut(s) 103
HphI GGTGA 1 cut(s) 53
HpyAV CCTTC 1 cut(s) 171
HpyCH4V TGCA 4 cut(s) 13, 19, 81, 97
Hsp92II CATG 3 cut(s) 19, 74, 112
LpnPI CCDG 1 cut(s) 167
Lsp1109I GCAGC 2 cut(s) 81, 144
MaeI CTAG 2 cut(s) 182, 187
MaeIII GTNAC 1 cut(s) 104
MfeI CAATTG 1 cut(s) 47
MluCI AATT 2 cut(s) 47, 166
MlyI GAGTC 1 cut(s) 112
MnlI CCTC 1 cut(s) 171
MspA1I CMGCKG 1 cut(s) 157
MunI CAATTG 1 cut(s) 47
NlaIII CATG 3 cut(s) 19, 74, 112
NmuCI GTSAC 1 cut(s) 104
NspI RCATGY 2 cut(s) 19, 112
PciI ACATGT 1 cut(s) 108
PkrI GCNGC 2 cut(s) 96, 159
PleI GAGTC 1 cut(s) 111
PpsI GAGTC 1 cut(s) 111
PscI ACATGT 1 cut(s) 108
PspPI GGNCC 1 cut(s) 151
PstI CTGCAG 1 cut(s) 99
PvuII CAGCTG 1 cut(s) 157
SatI GCNGC 2 cut(s) 95, 158
Sau96I GGNCC 1 cut(s) 151
SchI GAGTC 1 cut(s) 112
SetI ASST 3 cut(s) 25, 39, 159
SfcI CTRYAG 1 cut(s) 95
SgeI CNNG 8 cut(s) 28, 32, 83, 100, 121, 150, 154, 166
Sse9I AATT 2 cut(s) 47, 166
SspMI CTAG 2 cut(s) 182, 187
TaqI TCGA 1 cut(s) 124
TasI AATT 2 cut(s) 47, 166
TseFI GTSAC 1 cut(s) 104
TseI GCWGC 2 cut(s) 94, 157
Tsp45I GTSAC 1 cut(s) 104
XagI CCTNNNNNAGG 1 cut(s) 175
XapI RAATTY 1 cut(s) 166
XceI RCATGY 2 cut(s) 19, 112
XspI CTAG 2 cut(s) 182, 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.