Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr2D

Orthogroup ID

OG0011612

Physical Location & Seq

Genomic Coordinates Reverse (-)

87890822 .. 87892350

Gene Structure 1529 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh2DG653900.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 519 bp

ATGGGGACGCAGTTGCTCGATTTGGCCGTGTCTGATGGTGCCACCTCCAAAGCTGCTGTCAAGTTTTGGATCCCACATGCCACAGCGATAAAGATCAATGTTATCTCTTACTGGAGTAAGGCTAACAACAAAGTGGCTGTAGTTGTCGTTGCCCGTTGTTCCCGTTGTACTCTTGATGCTGTTGATGTCAATCTTGGCCTCGCTTCATCTGCCGCAGATGCGGAGGCCAGGGCGTGCCTGTTTGGTGTGAGACTTGCAAAGGATCATCAGATGGAGCTGAGAAATGTCGTCTTTGAGACACATTTCTTCAGCAATTTCATGGAGGGTCACTATGCTGATGATGCTGCTGTTAGGCGGATCGTGGATAAACTCAAACAACAAGTACTTGGTAGCAGGATTGCCTGTCTAAACATAAAACATAAACTCAAACTTGATAGCAAAGGTAATTTAAGTAAAGCTAATGAACCATTCCCCATAAATATATCTCATCCATCATCATTCATCATAGTTAATCACTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

172

Amino Acids

18.84

Weight (kDa)

9.28

Isoelectric Point (pI)

34.63

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011612)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0171131 RchiOBHm_Chr2g0171241 RchiOBHm_Chr5g0041781
rosa_laevigata	RLG00000022005 RLG00000022007
rosa_multiflora	Rmu_sc0003517.1_g000002
rosa_roxburghii	Rroxscaffold_2G00080920
rosa_samantha	Rh1AG148400 Rh1BG074400 Rh1CG139900 Rh1DG155200 Rh2AG625800 Rh2AG627600 Rh2AG639000 Rh2BG638200 Rh2CG605200 Rh2CG607000 Rh2DG653900 Rh2DG655400
rosa_wichuraiana	Rw2G051840

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	38
AciI	CCGC	3 cut(s)	213, 221, 355
AclWI	GGATC	4 cut(s)	64, 77, 270, 365
AcoI	YGGCCR	1 cut(s)	24
AcuI	CTGAAG	1 cut(s)	292
AfaI	GTAC	2 cut(s)	169, 384
AjnI	CCWGG	1 cut(s)	227
AluBI	AGCT	3 cut(s)	53, 277, 458
AluI	AGCT	3 cut(s)	53, 277, 458
Alw26I	GTCTC	2 cut(s)	244, 290
AlwI	GGATC	4 cut(s)	64, 77, 270, 365
AoxI	GGCC	3 cut(s)	24, 196, 225
ApeKI	GCWGC	2 cut(s)	53, 344
ArsI	GACNNNNNNTTYG	2 cut(s)	42, 74
BamHI	GGATCC	1 cut(s)	69
BanI	GGYRCC	1 cut(s)	38
BbvI	GCAGC	2 cut(s)	40, 331
BccI	CCATC	3 cut(s)	29, 265, 499
BceAI	ACGGC	1 cut(s)	11
BciT130I	CCWGG	1 cut(s)	229
BcoDI	GTCTC	2 cut(s)	244, 290
BfaI	CTAG	1 cut(s)	517
BfmI	CTRYAG	1 cut(s)	138
BisI	GCNGC	3 cut(s)	54, 213, 345
BlsI	GCNGC	3 cut(s)	55, 214, 346
BmcAI	AGTACT	1 cut(s)	384
Bme1390I	CCNGG	1 cut(s)	229
BmiI	GGNNCC	2 cut(s)	40, 71
BmrFI	CCNGG	1 cut(s)	229
BmsI	GCATC	3 cut(s)	166, 208, 331
BpmI	CTGGAG	1 cut(s)	133
BsaBI	GATNNNNATC	2 cut(s)	92, 189
BsaJI	CCNNGG	1 cut(s)	228
Bse1I	ACTGG	1 cut(s)	116
Bse8I	GATNNNNATC	2 cut(s)	92, 189
BseBI	CCWGG	1 cut(s)	229
BseDI	CCNNGG	1 cut(s)	228
BseGI	GGATG	1 cut(s)	487
BseJI	GATNNNNATC	2 cut(s)	92, 189
BseMII	CTCAG	1 cut(s)	269
BseNI	ACTGG	1 cut(s)	116
BseXI	GCAGC	2 cut(s)	40, 331
BshFI	GGCC	3 cut(s)	26, 198, 227
BshNI	GGYRCC	1 cut(s)	38
BslFI	GGGAC	1 cut(s)	19
BsmAI	GTCTC	2 cut(s)	244, 290
BsmFI	GGGAC	1 cut(s)	19
BsnI	GGCC	3 cut(s)	26, 198, 227
Bsp143I	GATC	4 cut(s)	69, 93, 262, 357
BspACI	CCGC	3 cut(s)	213, 221, 355
BspANI	GGCC	3 cut(s)	26, 198, 227
BspCNI	CTCAG	1 cut(s)	270
BspLI	GGNNCC	2 cut(s)	40, 71
BspPI	GGATC	4 cut(s)	64, 77, 270, 365
BspT107I	GGYRCC	1 cut(s)	38
BsrI	ACTGG	1 cut(s)	116
BssECI	CCNNGG	1 cut(s)	228
BssMI	GATC	4 cut(s)	69, 93, 262, 357
Bst2UI	CCWGG	1 cut(s)	229
BstC8I	GCNNGC	1 cut(s)	235
BstDEI	CTNAG	1 cut(s)	278
BstF5I	GGATG	1 cut(s)	487
BstKTI	GATC	4 cut(s)	72, 96, 265, 360
BstMAI	GTCTC	2 cut(s)	244, 290
BstMBI	GATC	4 cut(s)	69, 93, 262, 357
BstMWI	GCNNNNNNNGC	3 cut(s)	209, 218, 341
BstNI	CCWGG	1 cut(s)	229
BstNSI	RCATGY	1 cut(s)	80
BstSCI	CCNGG	1 cut(s)	227
BstSFI	CTRYAG	1 cut(s)	138
BstV1I	GCAGC	2 cut(s)	40, 331
BstX2I	RGATCY	1 cut(s)	69
BstYI	RGATCY	1 cut(s)	69
BsuRI	GGCC	3 cut(s)	26, 198, 227
BtsCI	GGATG	1 cut(s)	487
Cac8I	GCNNGC	1 cut(s)	235
CseI	GACGC	1 cut(s)	16
Csp6I	GTAC	2 cut(s)	168, 383
CviAII	CATG	2 cut(s)	77, 319
CviJI	RGCY	8 cut(s)	26, 53, 122, 137, 198, 227, 277, 458
CviKI_1	RGCY	8 cut(s)	26, 53, 122, 137, 198, 227, 277, 458
CviQI	GTAC	2 cut(s)	168, 383
DdeI	CTNAG	1 cut(s)	278
DpnI	GATC	4 cut(s)	71, 95, 264, 359
DpnII	GATC	4 cut(s)	69, 93, 262, 357
EaeI	YGGCCR	1 cut(s)	24
EciI	GGCGGA	1 cut(s)	370
Eco57I	CTGAAG	1 cut(s)	292
EcoRII	CCWGG	1 cut(s)	227
FaeI	CATG	2 cut(s)	80, 322
FaiI	YATR	8 cut(s)	78, 320, 333, 413, 420, 476, 482, 506
FaqI	GGGAC	1 cut(s)	19
FatI	CATG	2 cut(s)	76, 318
Fnu4HI	GCNGC	3 cut(s)	54, 213, 345
FokI	GGATG	1 cut(s)	474
Fsp4HI	GCNGC	3 cut(s)	54, 213, 345
FspBI	CTAG	1 cut(s)	517
GluI	GCNGC	3 cut(s)	54, 213, 345
GsuI	CTGGAG	1 cut(s)	133
HaeIII	GGCC	3 cut(s)	26, 198, 227
HgaI	GACGC	1 cut(s)	16
Hin1II	CATG	2 cut(s)	80, 322
Hpy188I	TCNGA	2 cut(s)	34, 270
Hpy188III	TCNNGA	1 cut(s)	173
HpyCH4V	TGCA	1 cut(s)	257
HpyF10VI	GCNNNNNNNGC	3 cut(s)	209, 218, 341
HpyF3I	CTNAG	1 cut(s)	278
Hsp92II	CATG	2 cut(s)	80, 322
Kzo9I	GATC	4 cut(s)	69, 93, 262, 357
LmnI	GCTCC	1 cut(s)	274
LpnPI	CCDG	6 cut(s)	97, 214, 241, 251, 379, 415
Lsp1109I	GCAGC	2 cut(s)	40, 331
LweI	GCATC	3 cut(s)	166, 208, 331
MaeI	CTAG	1 cut(s)	517
MaeIII	GTNAC	1 cut(s)	326
MalI	GATC	4 cut(s)	71, 95, 264, 359
MboI	GATC	4 cut(s)	69, 93, 262, 357
MboII	GAAGA	1 cut(s)	298
MflI	RGATCY	1 cut(s)	69
MluCI	AATT	2 cut(s)	313, 445
MnlI	CCTC	4 cut(s)	55, 209, 217, 316
MseI	TTAA	2 cut(s)	449, 510
MspR9I	CCNGG	1 cut(s)	229
MvaI	CCWGG	1 cut(s)	229
MwoI	GCNNNNNNNGC	3 cut(s)	209, 218, 341
NdeII	GATC	4 cut(s)	69, 93, 262, 357
NlaIII	CATG	2 cut(s)	80, 322
NlaIV	GGNNCC	2 cut(s)	40, 71
NmuCI	GTSAC	1 cut(s)	326
NspI	RCATGY	1 cut(s)	80
PcsI	WCGNNNNNNNCGW	1 cut(s)	24
PkrI	GCNGC	3 cut(s)	55, 214, 346
Psp6I	CCWGG	1 cut(s)	227
PspGI	CCWGG	1 cut(s)	227
PspN4I	GGNNCC	2 cut(s)	40, 71
PsuI	RGATCY	1 cut(s)	69
RsaI	GTAC	2 cut(s)	169, 384
RsaNI	GTAC	2 cut(s)	168, 383
SaqAI	TTAA	2 cut(s)	449, 510
SatI	GCNGC	3 cut(s)	54, 213, 345
Sau3AI	GATC	4 cut(s)	69, 93, 262, 357
ScaI	AGTACT	1 cut(s)	384
ScrFI	CCNGG	1 cut(s)	229
SetI	ASST	5 cut(s)	47, 55, 279, 445, 460
SfaNI	GCATC	3 cut(s)	166, 208, 331
SfcI	CTRYAG	1 cut(s)	138
Sse9I	AATT	2 cut(s)	313, 445
SsiI	CCGC	3 cut(s)	213, 221, 355
SspMI	CTAG	1 cut(s)	517
StyD4I	CCNGG	1 cut(s)	227
TaqI	TCGA	1 cut(s)	18
TasI	AATT	2 cut(s)	313, 445
TatI	WGTACW	2 cut(s)	167, 382
TauI	GCSGC	1 cut(s)	215
Tru1I	TTAA	2 cut(s)	449, 510
Tru9I	TTAA	2 cut(s)	449, 510
TseFI	GTSAC	1 cut(s)	326
TseI	GCWGC	2 cut(s)	53, 344
Tsp45I	GTSAC	1 cut(s)	326
TspDTI	ATGAA	4 cut(s)	195, 307, 477, 490
XceI	RCATGY	1 cut(s)	80
XspI	CTAG	1 cut(s)	517
ZrmI	AGTACT	1 cut(s)	384

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.