RchiOBHm_Chr5g0052881

in the synthesis of the GDP-mannose and dolichol-phosphate-mannose required for a number of critical mannosyl transfer reactions

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
55053689 .. 55054533
845 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 135 bp
ATGGTTATAGCTTTACTCCCCATACCTAAGGATCTATGCAAAACTTATATCTCTATGTTTATGGGTGACTATGATTATGTATTTTCTGAGAATGGTCTTATGGCTCACAAAGATGTGAAGCTCATTGGCACCTAG

Protein Analysis

44

Amino Acids

4.98

Weight (kDa)

5.45

Isoelectric Point (pI)

21.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 128
AclWI GGATC 1 cut(s) 39
AluBI AGCT 2 cut(s) 11, 121
AluI AGCT 2 cut(s) 11, 121
AlwI GGATC 1 cut(s) 39
AsuHPI GGTGA 1 cut(s) 77
AxyI CCTNAGG 1 cut(s) 27
BanI GGYRCC 1 cut(s) 128
BfaI CTAG 1 cut(s) 133
BmiI GGNNCC 1 cut(s) 130
Bse21I CCTNAGG 1 cut(s) 27
BseMII CTCAG 1 cut(s) 78
BshNI GGYRCC 1 cut(s) 128
Bsp143I GATC 1 cut(s) 31
BspCNI CTCAG 1 cut(s) 79
BspLI GGNNCC 1 cut(s) 130
BspPI GGATC 1 cut(s) 39
BspT107I GGYRCC 1 cut(s) 128
BssMI GATC 1 cut(s) 31
BstDEI CTNAG 2 cut(s) 27, 87
BstKTI GATC 1 cut(s) 34
BstMBI GATC 1 cut(s) 31
BstX2I RGATCY 1 cut(s) 31
BstYI RGATCY 1 cut(s) 31
Bsu36I CCTNAGG 1 cut(s) 27
CviJI RGCY 3 cut(s) 11, 104, 121
CviKI_1 RGCY 3 cut(s) 11, 104, 121
DdeI CTNAG 2 cut(s) 27, 87
DpnI GATC 1 cut(s) 33
DpnII GATC 1 cut(s) 31
Eco81I CCTNAGG 1 cut(s) 27
FaiI YATR 9 cut(s) 8, 23, 37, 48, 56, 62, 72, 78, 101
FspBI CTAG 1 cut(s) 133
HphI GGTGA 1 cut(s) 77
Hpy188I TCNGA 1 cut(s) 88
HpyCH4V TGCA 1 cut(s) 39
HpyF3I CTNAG 2 cut(s) 27, 87
Kzo9I GATC 1 cut(s) 31
MaeI CTAG 1 cut(s) 133
MaeIII GTNAC 1 cut(s) 65
MalI GATC 1 cut(s) 33
MboI GATC 1 cut(s) 31
MflI RGATCY 1 cut(s) 31
MslI CAYNNNNRTG 1 cut(s) 111
NdeII GATC 1 cut(s) 31
NlaIV GGNNCC 1 cut(s) 130
NmuCI GTSAC 1 cut(s) 65
PspN4I GGNNCC 1 cut(s) 130
PsuI RGATCY 1 cut(s) 31
RseI CAYNNNNRTG 1 cut(s) 111
Sau3AI GATC 1 cut(s) 31
SetI ASST 4 cut(s) 13, 28, 123, 134
SmiMI CAYNNNNRTG 1 cut(s) 111
SspMI CTAG 1 cut(s) 133
TseFI GTSAC 1 cut(s) 65
Tsp45I GTSAC 1 cut(s) 65
XspI CTAG 1 cut(s) 133
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.