RchiOBHm_Chr5g0056551

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
60226996 .. 60230518
3523 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 210 bp
ATGGCACTATCACGGAATGCTATTGTTGCTACTGGCCTGGTAGTTTTCGCATCTGCGGGGTTGGCATTTCCCTTTTACATGGCGTCATCAAAAACGCCTGTTATCGATCCAACAAAGCCACTGTCACCTCAGGCAACTTTTCGAGGGCCTTACATAAACACTGGTTCGCGTGACGTTGGACCTGATCATCAGACCTACCCAAAGAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.35

Weight (kDa)

9.87

Isoelectric Point (pI)

46.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 169
AciI CCGC 1 cut(s) 56
AclWI GGATC 1 cut(s) 101
AcyI GRCGYC 1 cut(s) 83
AjnI CCWGG 1 cut(s) 36
AlwI GGATC 1 cut(s) 101
AoxI GGCC 2 cut(s) 34, 146
ArsI GACNNNNNNTTYG 2 cut(s) 107, 139
AspS9I GGNCC 2 cut(s) 146, 179
AsuHPI GGTGA 1 cut(s) 117
AvaII GGWCC 1 cut(s) 179
AxyI CCTNAGG 1 cut(s) 129
BciT130I CCWGG 1 cut(s) 38
BclI TGATCA 1 cut(s) 184
Bme1390I CCNGG 1 cut(s) 38
Bme18I GGWCC 1 cut(s) 179
BmgT120I GGNCC 2 cut(s) 146, 179
BmrFI CCNGG 1 cut(s) 38
BmsI GCATC 1 cut(s) 59
Bsa29I ATCGAT 1 cut(s) 105
BsaHI GRCGYC 1 cut(s) 83
Bse1I ACTGG 2 cut(s) 37, 166
Bse21I CCTNAGG 1 cut(s) 129
BseBI CCWGG 1 cut(s) 38
BseCI ATCGAT 1 cut(s) 105
BseMII CTCAG 1 cut(s) 143
BseNI ACTGG 2 cut(s) 37, 166
Bsh1236I CGCG 1 cut(s) 169
BshFI GGCC 2 cut(s) 36, 148
BshVI ATCGAT 1 cut(s) 105
BsmI GAATGC 1 cut(s) 22
BsnI GGCC 2 cut(s) 36, 148
Bsp143I GATC 2 cut(s) 106, 184
BspACI CCGC 1 cut(s) 56
BspANI GGCC 2 cut(s) 36, 148
BspCNI CTCAG 1 cut(s) 142
BspDI ATCGAT 1 cut(s) 105
BspFNI CGCG 1 cut(s) 169
BspPI GGATC 1 cut(s) 101
BsrI ACTGG 2 cut(s) 37, 166
BssMI GATC 2 cut(s) 106, 184
BssNI GRCGYC 1 cut(s) 83
Bst2UI CCWGG 1 cut(s) 38
Bst4CI ACNGT 1 cut(s) 123
BstACI GRCGYC 1 cut(s) 83
BstDEI CTNAG 1 cut(s) 129
BstFNI CGCG 1 cut(s) 169
BstKTI GATC 2 cut(s) 109, 187
BstMBI GATC 2 cut(s) 106, 184
BstMWI GCNNNNNNNGC 2 cut(s) 26, 62
BstNI CCWGG 1 cut(s) 38
BstSCI CCNGG 1 cut(s) 36
BstUI CGCG 1 cut(s) 169
Bsu15I ATCGAT 1 cut(s) 105
Bsu36I CCTNAGG 1 cut(s) 129
BsuRI GGCC 2 cut(s) 36, 148
BsuTUI ATCGAT 1 cut(s) 105
BtsIMutI CAGTG 2 cut(s) 119, 159
Cfr13I GGNCC 2 cut(s) 146, 179
ClaI ATCGAT 1 cut(s) 105
CseI GACGC 1 cut(s) 72
CviAII CATG 1 cut(s) 79
CviJI RGCY 3 cut(s) 36, 118, 148
CviKI_1 RGCY 3 cut(s) 36, 118, 148
DdeI CTNAG 1 cut(s) 129
DpnI GATC 2 cut(s) 108, 186
DpnII GATC 2 cut(s) 106, 184
Eco47I GGWCC 1 cut(s) 179
Eco81I CCTNAGG 1 cut(s) 129
EcoO109I RGGNCCY 1 cut(s) 146
EcoRII CCWGG 1 cut(s) 36
FaeI CATG 1 cut(s) 82
FaiI YATR 2 cut(s) 80, 155
FatI CATG 1 cut(s) 78
FauI CCCGC 1 cut(s) 49
FbaI TGATCA 1 cut(s) 184
HaeIII GGCC 2 cut(s) 36, 148
HgaI GACGC 1 cut(s) 72
Hin1I GRCGYC 1 cut(s) 83
Hin1II CATG 1 cut(s) 82
HphI GGTGA 1 cut(s) 117
Hpy188I TCNGA 1 cut(s) 192
HpyCH4III ACNGT 1 cut(s) 123
HpyCH4IV ACGT 1 cut(s) 174
HpyF10VI GCNNNNNNNGC 2 cut(s) 26, 62
HpyF3I CTNAG 1 cut(s) 129
HpySE526I ACGT 1 cut(s) 174
Hsp92I GRCGYC 1 cut(s) 83
Hsp92II CATG 1 cut(s) 82
Ksp22I TGATCA 1 cut(s) 184
Kzo9I GATC 2 cut(s) 106, 184
LpnPI CCDG 7 cut(s) 18, 23, 50, 111, 116, 147, 195
LweI GCATC 1 cut(s) 59
MaeII ACGT 1 cut(s) 174
MaeIII GTNAC 2 cut(s) 123, 170
MalI GATC 2 cut(s) 108, 186
MboI GATC 2 cut(s) 106, 184
MmeI TCCRAC 2 cut(s) 134, 157
MnlI CCTC 2 cut(s) 137, 138
MspR9I CCNGG 1 cut(s) 38
Mva1269I GAATGC 1 cut(s) 22
MvaI CCWGG 1 cut(s) 38
MvnI CGCG 1 cut(s) 169
MwoI GCNNNNNNNGC 2 cut(s) 26, 62
NdeII GATC 2 cut(s) 106, 184
NlaIII CATG 1 cut(s) 82
NmuCI GTSAC 2 cut(s) 123, 170
PctI GAATGC 1 cut(s) 22
Psp6I CCWGG 1 cut(s) 36
PspGI CCWGG 1 cut(s) 36
PspPI GGNCC 2 cut(s) 146, 179
Sau3AI GATC 2 cut(s) 106, 184
Sau96I GGNCC 2 cut(s) 146, 179
ScrFI CCNGG 1 cut(s) 38
SetI ASST 4 cut(s) 130, 177, 184, 197
SfaNI GCATC 1 cut(s) 59
SinI GGWCC 1 cut(s) 179
SsiI CCGC 1 cut(s) 56
StyD4I CCNGG 1 cut(s) 36
TaaI ACNGT 1 cut(s) 123
TaiI ACGT 1 cut(s) 177
TaqI TCGA 2 cut(s) 105, 142
TscAI CASTG 2 cut(s) 126, 166
TseFI GTSAC 2 cut(s) 123, 170
Tsp45I GTSAC 2 cut(s) 123, 170
TspGWI ACGGA 1 cut(s) 28
TspRI CASTG 2 cut(s) 126, 166
VpaK11BI GGWCC 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.