RchiOBHm_Chr4g0402301
ERF Family

Transglutaminase-like superfamily

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
20830879 .. 20831706
828 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 363 bp
ATGATGGCTGAATATTCTGACCATAGGGGATCTCGAGTTGGGGAAGAATTTTTGATCTGGCCGCAAACAGGATATCCAGAGGAGCTGTTCAAGGTATCGGATTTAACAAGCAATTCACTGTCAGGGCTTGAGATAGCTACAAACGGAGACATTATTGGGATTGCTTTGGCCAATCTTGTTAGGCTTCACTGGAAACCTGCTTCAAGATCAACTCATGAACTGATGTTGACTTCTCCACTCAGGCATGTTCACAATGCTCATGATAAACTTTACAAAATCACTAATTCAAAGCTCCTCTGTTACGACCCCAAGAACTTAGGTAATGTTTCTTTTGCCTCCTATGGAAGCTGTAAATTTTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

120

Amino Acids

13.5

Weight (kDa)

7.01

Isoelectric Point (pI)

28.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 205
AciI CCGC 1 cut(s) 62
AclWI GGATC 1 cut(s) 37
AcoI YGGCCR 2 cut(s) 59, 168
AcsI RAATTY 2 cut(s) 47, 353
AfiI CCNNNNNNNGG 1 cut(s) 68
AgsI TTSAA 3 cut(s) 91, 204, 288
AluBI AGCT 4 cut(s) 85, 137, 292, 348
AluI AGCT 4 cut(s) 85, 137, 292, 348
Alw26I GTCTC 1 cut(s) 141
AlwI GGATC 1 cut(s) 37
Ama87I CYCGRG 1 cut(s) 33
AoxI GGCC 2 cut(s) 59, 168
ApoI RAATTY 2 cut(s) 47, 353
AvaI CYCGRG 1 cut(s) 33
BalI TGGCCA 1 cut(s) 170
BcoDI GTCTC 1 cut(s) 141
BfuAI ACCTGC 1 cut(s) 205
BisI GCNGC 1 cut(s) 62
BlsI GCNGC 1 cut(s) 63
BmeT110I CYCGRG 1 cut(s) 33
BpuEI CTTGAG 1 cut(s) 149
Bsc4I CCNNNNNNNGG 1 cut(s) 68
Bse1I ACTGG 1 cut(s) 194
BseLI CCNNNNNNNGG 1 cut(s) 68
BseMII CTCAG 1 cut(s) 253
BseNI ACTGG 1 cut(s) 194
BseRI GAGGAG 2 cut(s) 95, 284
BshFI GGCC 2 cut(s) 61, 170
BsiHKCI CYCGRG 1 cut(s) 33
BslI CCNNNNNNNGG 1 cut(s) 68
BsmAI GTCTC 1 cut(s) 141
BsnI GGCC 2 cut(s) 61, 170
BsoBI CYCGRG 1 cut(s) 33
Bsp143I GATC 3 cut(s) 29, 54, 206
BspACI CCGC 1 cut(s) 62
BspANI GGCC 2 cut(s) 61, 170
BspCNI CTCAG 1 cut(s) 252
BspHI TCATGA 2 cut(s) 214, 259
BspMI ACCTGC 1 cut(s) 205
BspPI GGATC 1 cut(s) 37
BsrI ACTGG 1 cut(s) 194
BssMI GATC 3 cut(s) 29, 54, 206
Bst4CI ACNGT 1 cut(s) 120
BstDEI CTNAG 2 cut(s) 239, 316
BstKTI GATC 3 cut(s) 32, 57, 209
BstMAI GTCTC 1 cut(s) 141
BstMBI GATC 3 cut(s) 29, 54, 206
BstNSI RCATGY 1 cut(s) 248
BstX2I RGATCY 1 cut(s) 29
BstYI RGATCY 1 cut(s) 29
BsuRI GGCC 2 cut(s) 61, 170
BtsIMutI CAGTG 2 cut(s) 116, 187
BveI ACCTGC 1 cut(s) 205
CciI TCATGA 2 cut(s) 214, 259
CviAII CATG 3 cut(s) 215, 245, 260
CviJI RGCY 9 cut(s) 8, 61, 85, 127, 137, 170, 184, 292, 348
CviKI_1 RGCY 9 cut(s) 8, 61, 85, 127, 137, 170, 184, 292, 348
DdeI CTNAG 2 cut(s) 239, 316
DpnI GATC 3 cut(s) 31, 56, 208
DpnII GATC 3 cut(s) 29, 54, 206
EaeI YGGCCR 2 cut(s) 59, 168
Eco32I GATATC 1 cut(s) 74
Eco88I CYCGRG 1 cut(s) 33
EcoRV GATATC 1 cut(s) 74
FaeI CATG 3 cut(s) 218, 248, 263
FaiI YATR 5 cut(s) 24, 216, 246, 261, 342
FatI CATG 3 cut(s) 214, 244, 259
Fnu4HI GCNGC 1 cut(s) 62
Fsp4HI GCNGC 1 cut(s) 62
GluI GCNGC 1 cut(s) 62
HaeIII GGCC 2 cut(s) 61, 170
Hin1II CATG 3 cut(s) 218, 248, 263
HincII GTYRAC 1 cut(s) 228
HindII GTYRAC 1 cut(s) 228
Hpy166II GTNNAC 2 cut(s) 228, 250
Hpy188I TCNGA 2 cut(s) 19, 100
Hpy188III TCNNGA 5 cut(s) 33, 77, 204, 215, 260
Hpy8I GTNNAC 2 cut(s) 228, 250
HpyCH4III ACNGT 1 cut(s) 120
HpyF3I CTNAG 2 cut(s) 239, 316
Hsp92II CATG 3 cut(s) 218, 248, 263
Kzo9I GATC 3 cut(s) 29, 54, 206
LmnI GCTCC 2 cut(s) 82, 297
LpnPI CCDG 7 cut(s) 43, 54, 90, 108, 175, 210, 226
MaeIII GTNAC 1 cut(s) 299
MalI GATC 3 cut(s) 31, 56, 208
MboI GATC 3 cut(s) 29, 54, 206
MboII GAAGA 1 cut(s) 56
MflI RGATCY 1 cut(s) 29
MlsI TGGCCA 1 cut(s) 170
MluCI AATT 4 cut(s) 47, 112, 283, 353
MluNI TGGCCA 1 cut(s) 170
MnlI CCTC 3 cut(s) 73, 305, 346
Mox20I TGGCCA 1 cut(s) 170
MscI TGGCCA 1 cut(s) 170
MseI TTAA 2 cut(s) 104, 361
Msp20I TGGCCA 1 cut(s) 170
NdeII GATC 3 cut(s) 29, 54, 206
NlaIII CATG 3 cut(s) 218, 248, 263
NspI RCATGY 1 cut(s) 248
PaeR7I CTCGAG 1 cut(s) 33
PagI TCATGA 2 cut(s) 214, 259
PkrI GCNGC 1 cut(s) 63
PsuI RGATCY 1 cut(s) 29
SaqAI TTAA 2 cut(s) 104, 361
SatI GCNGC 1 cut(s) 62
Sau3AI GATC 3 cut(s) 29, 54, 206
SetI ASST 7 cut(s) 87, 96, 139, 199, 294, 322, 350
Sfr274I CTCGAG 1 cut(s) 33
SlaI CTCGAG 1 cut(s) 33
SmlI CTYRAG 2 cut(s) 33, 128
SmoI CTYRAG 2 cut(s) 33, 128
Sse9I AATT 4 cut(s) 47, 112, 283, 353
SsiI CCGC 1 cut(s) 62
SspI AATATT 1 cut(s) 14
TaaI ACNGT 1 cut(s) 120
TaqI TCGA 1 cut(s) 34
TasI AATT 4 cut(s) 47, 112, 283, 353
TauI GCSGC 1 cut(s) 64
Tru1I TTAA 2 cut(s) 104, 361
Tru9I TTAA 2 cut(s) 104, 361
TscAI CASTG 2 cut(s) 123, 194
TspDTI ATGAA 1 cut(s) 231
TspGWI ACGGA 1 cut(s) 159
TspRI CASTG 2 cut(s) 123, 194
XapI RAATTY 2 cut(s) 47, 353
XceI RCATGY 1 cut(s) 248
XhoI CTCGAG 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.