Rh5CG116700
ERF Family

Transglutaminase-like superfamily

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0007426
Physical Location & Seq
Forward (+)
9646964 .. 9650446
3483 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG116700.1

Sequence Viewer

Length: 462 bp
ATGGAAAGGAAAGTTGATGTTTGCCGAAGACTTAGTCTAACCATAGTGGGATCTCGAGTTGGGGAAGAATTTTTGATCTGGCCGCAAACAGGATATCCAGAGGAGCTGTTCAAGGTAACTTCAGGACACAGTCTGTTTGCAATTGTCAATGGAAGGTGTGTCGAAGACCCTAGATCAAAGGCATCGGATTTAACAAGCAATTCACTGTCAGGGCTTGAGATAGCTACAAACCTAGACATTATTGGGATTGCTTTAGCCAATCTTGTTAGGCTTCACTGGAAACTTGCTTTAAGATCAACTCATGAACTGATGCTGACTTCTCCACTCAGGCATGTTCACAATGCTCATGATAAACTTTACAAAATCACTAATTCAAAGGCACCTCTGTTACGACCCCAAGAACTTAGCTTGACATACATGACTAGCAAGTTCCCGTTGGTTTCTATATTAGAAATGCCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TPR_9 Transglut_core2

Protein Analysis

153

Amino Acids

17.2

Weight (kDa)

9.0

Isoelectric Point (pI)

38.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 379
AciI CCGC 1 cut(s) 83
AclWI GGATC 1 cut(s) 58
AcoI YGGCCR 1 cut(s) 80
AcsI RAATTY 1 cut(s) 68
AcuI CTGAAG 1 cut(s) 105
AfiI CCNNNNNNNGG 1 cut(s) 89
AgsI TTSAA 2 cut(s) 112, 375
AluBI AGCT 3 cut(s) 106, 224, 408
AluI AGCT 3 cut(s) 106, 224, 408
AlwI GGATC 1 cut(s) 58
Ama87I CYCGRG 1 cut(s) 54
AoxI GGCC 1 cut(s) 80
ApoI RAATTY 1 cut(s) 68
ArsI GACNNNNNNTTYG 2 cut(s) 19, 51
AvaI CYCGRG 1 cut(s) 54
BanI GGYRCC 1 cut(s) 379
BbsI GAAGAC 2 cut(s) 34, 171
BfaI CTAG 3 cut(s) 171, 233, 423
BisI GCNGC 1 cut(s) 83
BlsI GCNGC 1 cut(s) 84
BmeT110I CYCGRG 1 cut(s) 54
BmiI GGNNCC 1 cut(s) 381
BmsI GCATC 2 cut(s) 191, 300
BpiI GAAGAC 2 cut(s) 34, 171
BpuEI CTTGAG 1 cut(s) 236
Bsc4I CCNNNNNNNGG 1 cut(s) 89
Bse1I ACTGG 1 cut(s) 281
BseLI CCNNNNNNNGG 1 cut(s) 89
BseMII CTCAG 1 cut(s) 340
BseNI ACTGG 1 cut(s) 281
BseRI GAGGAG 1 cut(s) 116
BshFI GGCC 1 cut(s) 82
BshNI GGYRCC 1 cut(s) 379
BsiHKCI CYCGRG 1 cut(s) 54
BslI CCNNNNNNNGG 1 cut(s) 89
BsnI GGCC 1 cut(s) 82
BsoBI CYCGRG 1 cut(s) 54
Bsp143I GATC 4 cut(s) 50, 75, 173, 293
BspACI CCGC 1 cut(s) 83
BspANI GGCC 1 cut(s) 82
BspCNI CTCAG 1 cut(s) 339
BspHI TCATGA 2 cut(s) 301, 346
BspLI GGNNCC 1 cut(s) 381
BspPI GGATC 1 cut(s) 58
BspT107I GGYRCC 1 cut(s) 379
BsrI ACTGG 1 cut(s) 281
BssMI GATC 4 cut(s) 50, 75, 173, 293
Bst4CI ACNGT 2 cut(s) 131, 207
BstDEI CTNAG 3 cut(s) 32, 326, 404
BstKTI GATC 4 cut(s) 53, 78, 176, 296
BstMBI GATC 4 cut(s) 50, 75, 173, 293
BstNSI RCATGY 1 cut(s) 335
BstV2I GAAGAC 2 cut(s) 34, 171
BstX2I RGATCY 1 cut(s) 50
BstYI RGATCY 1 cut(s) 50
BsuRI GGCC 1 cut(s) 82
BtsIMutI CAGTG 2 cut(s) 203, 274
CciI TCATGA 2 cut(s) 301, 346
CviAII CATG 4 cut(s) 302, 332, 347, 418
CviJI RGCY 7 cut(s) 82, 106, 214, 224, 257, 271, 408
CviKI_1 RGCY 7 cut(s) 82, 106, 214, 224, 257, 271, 408
DdeI CTNAG 3 cut(s) 32, 326, 404
DpnI GATC 4 cut(s) 52, 77, 175, 295
DpnII GATC 4 cut(s) 50, 75, 173, 293
EaeI YGGCCR 1 cut(s) 80
Eco32I GATATC 1 cut(s) 95
Eco57I CTGAAG 1 cut(s) 105
Eco88I CYCGRG 1 cut(s) 54
EcoRV GATATC 1 cut(s) 95
FaeI CATG 4 cut(s) 305, 335, 350, 421
FaiI YATR 8 cut(s) 44, 303, 333, 348, 415, 419, 446, 460
FatI CATG 4 cut(s) 301, 331, 346, 417
Fnu4HI GCNGC 1 cut(s) 83
Fsp4HI GCNGC 1 cut(s) 83
FspBI CTAG 3 cut(s) 171, 233, 423
GluI GCNGC 1 cut(s) 83
HaeIII GGCC 1 cut(s) 82
Hin1II CATG 4 cut(s) 305, 335, 350, 421
Hpy166II GTNNAC 1 cut(s) 337
Hpy188I TCNGA 1 cut(s) 187
Hpy188III TCNNGA 5 cut(s) 54, 98, 123, 302, 347
Hpy8I GTNNAC 1 cut(s) 337
HpyAV CCTTC 1 cut(s) 147
HpyCH4III ACNGT 2 cut(s) 131, 207
HpyCH4V TGCA 1 cut(s) 140
HpyF3I CTNAG 3 cut(s) 32, 326, 404
Hsp92II CATG 4 cut(s) 305, 335, 350, 421
Kzo9I GATC 4 cut(s) 50, 75, 173, 293
LmnI GCTCC 1 cut(s) 103
LpnPI CCDG 7 cut(s) 64, 75, 108, 111, 195, 262, 313
LweI GCATC 2 cut(s) 191, 300
MaeI CTAG 3 cut(s) 171, 233, 423
MaeIII GTNAC 2 cut(s) 115, 387
MalI GATC 4 cut(s) 52, 77, 175, 295
MboI GATC 4 cut(s) 50, 75, 173, 293
MboII GAAGA 3 cut(s) 39, 77, 176
MfeI CAATTG 1 cut(s) 141
MflI RGATCY 1 cut(s) 50
MluCI AATT 4 cut(s) 68, 141, 199, 370
MnlI CCTC 2 cut(s) 94, 393
MseI TTAA 2 cut(s) 191, 290
MunI CAATTG 1 cut(s) 141
NdeII GATC 4 cut(s) 50, 75, 173, 293
NlaIII CATG 4 cut(s) 305, 335, 350, 421
NlaIV GGNNCC 1 cut(s) 381
NspI RCATGY 1 cut(s) 335
PaeR7I CTCGAG 1 cut(s) 54
PagI TCATGA 2 cut(s) 301, 346
PflFI GACNNNGTC 2 cut(s) 33, 129
PkrI GCNGC 1 cut(s) 84
PspN4I GGNNCC 1 cut(s) 381
PsuI RGATCY 1 cut(s) 50
PsyI GACNNNGTC 2 cut(s) 33, 129
SaqAI TTAA 2 cut(s) 191, 290
SatI GCNGC 1 cut(s) 83
Sau3AI GATC 4 cut(s) 50, 75, 173, 293
SetI ASST 7 cut(s) 108, 117, 158, 226, 234, 385, 410
SfaNI GCATC 2 cut(s) 191, 300
Sfr274I CTCGAG 1 cut(s) 54
SlaI CTCGAG 1 cut(s) 54
SmlI CTYRAG 2 cut(s) 54, 215
SmoI CTYRAG 2 cut(s) 54, 215
Sse9I AATT 4 cut(s) 68, 141, 199, 370
SsiI CCGC 1 cut(s) 83
SspMI CTAG 3 cut(s) 171, 233, 423
TaaI ACNGT 2 cut(s) 131, 207
TaqI TCGA 2 cut(s) 55, 162
TasI AATT 4 cut(s) 68, 141, 199, 370
TauI GCSGC 1 cut(s) 85
Tru1I TTAA 2 cut(s) 191, 290
Tru9I TTAA 2 cut(s) 191, 290
TscAI CASTG 2 cut(s) 210, 281
TspDTI ATGAA 1 cut(s) 318
TspRI CASTG 2 cut(s) 210, 281
Tth111I GACNNNGTC 2 cut(s) 33, 129
XapI RAATTY 1 cut(s) 68
XceI RCATGY 1 cut(s) 335
XhoI CTCGAG 1 cut(s) 54
XspI CTAG 3 cut(s) 171, 233, 423
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.