RLG00000034679
ERF Family

Transglutaminase-like superfamily

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
Physical Location & Seq
Forward (+)
48244103 .. 48244607
505 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000034679

Sequence Viewer

Length: 306 bp
ATGTTCAAGGTAACTTCAGGACACAGTCTGTTTGTAATTGTCAATGGAAGGTGTGTCGAAGACCCTAGATCAAAGGCATCGGATTTAACAAGCAATTCACTGTCAGGGCTTGAGATAGCTACAAACCGAGACATTATTGGGATTGCTTTGGCCAATCTTGTTAGGCTTCACTGGAAACTTGCTTCAAGATCAACTCATGGACTGATGCTGACTTCTCCACTCAGGCATGTTCACAATGCTCATGATAAACTTTACAAAATCACTTATTCAAAGGCTCCTCTGTTACAACCCCAAGAACTTAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

11.26

Weight (kDa)

10.0

Isoelectric Point (pI)

32.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 150
AgsI TTSAA 3 cut(s) 7, 186, 270
AluBI AGCT 1 cut(s) 119
AluI AGCT 1 cut(s) 119
Alw26I GTCTC 1 cut(s) 123
AoxI GGCC 1 cut(s) 150
BalI TGGCCA 1 cut(s) 152
BbsI GAAGAC 1 cut(s) 66
BcoDI GTCTC 1 cut(s) 123
BfaI CTAG 1 cut(s) 66
BmiI GGNNCC 1 cut(s) 276
BmsI GCATC 2 cut(s) 86, 195
BpiI GAAGAC 1 cut(s) 66
BpuEI CTTGAG 1 cut(s) 131
Bse1I ACTGG 1 cut(s) 176
BseMII CTCAG 1 cut(s) 235
BseNI ACTGG 1 cut(s) 176
BseRI GAGGAG 1 cut(s) 267
BshFI GGCC 1 cut(s) 152
BsmAI GTCTC 1 cut(s) 123
BsnI GGCC 1 cut(s) 152
Bsp143I GATC 2 cut(s) 68, 188
BspANI GGCC 1 cut(s) 152
BspCNI CTCAG 1 cut(s) 234
BspHI TCATGA 1 cut(s) 241
BspLI GGNNCC 1 cut(s) 276
BsrI ACTGG 1 cut(s) 176
BssMI GATC 2 cut(s) 68, 188
Bst4CI ACNGT 2 cut(s) 26, 102
BstDEI CTNAG 2 cut(s) 221, 299
BstKTI GATC 2 cut(s) 71, 191
BstMAI GTCTC 1 cut(s) 123
BstMBI GATC 2 cut(s) 68, 188
BstNSI RCATGY 1 cut(s) 230
BstV2I GAAGAC 1 cut(s) 66
BsuRI GGCC 1 cut(s) 152
BtsIMutI CAGTG 2 cut(s) 98, 169
CciI TCATGA 1 cut(s) 241
CviAII CATG 3 cut(s) 197, 227, 242
CviJI RGCY 5 cut(s) 109, 119, 152, 166, 275
CviKI_1 RGCY 5 cut(s) 109, 119, 152, 166, 275
DdeI CTNAG 2 cut(s) 221, 299
DpnI GATC 2 cut(s) 70, 190
DpnII GATC 2 cut(s) 68, 188
EaeI YGGCCR 1 cut(s) 150
FaeI CATG 3 cut(s) 200, 230, 245
FaiI YATR 3 cut(s) 198, 228, 243
FatI CATG 3 cut(s) 196, 226, 241
FspBI CTAG 1 cut(s) 66
HaeIII GGCC 1 cut(s) 152
Hin1II CATG 3 cut(s) 200, 230, 245
Hpy166II GTNNAC 1 cut(s) 232
Hpy188I TCNGA 1 cut(s) 82
Hpy188III TCNNGA 3 cut(s) 18, 186, 242
Hpy8I GTNNAC 1 cut(s) 232
HpyAV CCTTC 1 cut(s) 42
HpyCH4III ACNGT 2 cut(s) 26, 102
HpyF3I CTNAG 2 cut(s) 221, 299
Hsp92II CATG 3 cut(s) 200, 230, 245
Kzo9I GATC 2 cut(s) 68, 188
LmnI GCTCC 1 cut(s) 280
LpnPI CCDG 4 cut(s) 3, 90, 157, 208
LweI GCATC 2 cut(s) 86, 195
MaeI CTAG 1 cut(s) 66
MaeIII GTNAC 2 cut(s) 10, 282
MalI GATC 2 cut(s) 70, 190
MboI GATC 2 cut(s) 68, 188
MboII GAAGA 1 cut(s) 71
MlsI TGGCCA 1 cut(s) 152
MluCI AATT 2 cut(s) 36, 94
MluNI TGGCCA 1 cut(s) 152
MnlI CCTC 1 cut(s) 288
Mox20I TGGCCA 1 cut(s) 152
MscI TGGCCA 1 cut(s) 152
MseI TTAA 1 cut(s) 86
Msp20I TGGCCA 1 cut(s) 152
NdeII GATC 2 cut(s) 68, 188
NlaIII CATG 3 cut(s) 200, 230, 245
NlaIV GGNNCC 1 cut(s) 276
NspI RCATGY 1 cut(s) 230
PagI TCATGA 1 cut(s) 241
PflFI GACNNNGTC 1 cut(s) 24
PspN4I GGNNCC 1 cut(s) 276
PsyI GACNNNGTC 1 cut(s) 24
SaqAI TTAA 1 cut(s) 86
Sau3AI GATC 2 cut(s) 68, 188
SetI ASST 4 cut(s) 12, 53, 121, 305
SfaNI GCATC 2 cut(s) 86, 195
SmlI CTYRAG 1 cut(s) 110
SmoI CTYRAG 1 cut(s) 110
Sse9I AATT 2 cut(s) 36, 94
SspMI CTAG 1 cut(s) 66
TaaI ACNGT 2 cut(s) 26, 102
TaqI TCGA 1 cut(s) 57
TasI AATT 2 cut(s) 36, 94
Tru1I TTAA 1 cut(s) 86
Tru9I TTAA 1 cut(s) 86
TscAI CASTG 2 cut(s) 105, 176
TspRI CASTG 2 cut(s) 105, 176
Tth111I GACNNNGTC 1 cut(s) 24
XceI RCATGY 1 cut(s) 230
XspI CTAG 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.