Rh4BG074000
ERF Family

Transglutaminase-like superfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Reverse (-)
13058686 .. 13059801
1116 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG074000.1

Sequence Viewer

Length: 417 bp
ATGCTTAGCATTATATACATTGAGGTTTGCCGAAGACTTAGTCTGACCATAGTGGGATCTCGAGTTGGGGAAGAATTTTTGATCTGGCCGCAAACAAGATATCCAGAGGAGCTGTTCAAAGCAACTTCAGGACACAGTCTGTTTGCAATTGTCAATGGAAGGTGTGTCAAAGACCCTAGATCAAAGGCATCGGATTTAACAAGCAATTCACTGTCAGGGCTTGAGATAGTTACAAACCGAGACATTATTGGGATTGCTTTGGCCAATCTTGTTAGGCTTCATTGGAAACTTGCTTCAAGATCAACTCATGGACTGATGCTGACTTCTCCACTCACGCATGTTCACAATGCTCATGATAAACTTTACAAAATCACTGATTCAAAGGCTCCTCTGTTACGACCCCAAGAACTTAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

138

Amino Acids

15.51

Weight (kDa)

9.69

Isoelectric Point (pI)

36.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Transglut_core2 PF13369 1 - 85 1.9e-07 Transglutaminase-like superfamily
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 89
AclWI GGATC 1 cut(s) 64
AcoI YGGCCR 2 cut(s) 86, 261
AcsI RAATTY 1 cut(s) 74
AcuI CTGAAG 1 cut(s) 111
AgsI TTSAA 3 cut(s) 118, 297, 381
AluBI AGCT 1 cut(s) 112
AluI AGCT 1 cut(s) 112
Alw26I GTCTC 1 cut(s) 234
AlwI GGATC 1 cut(s) 64
Ama87I CYCGRG 1 cut(s) 60
AoxI GGCC 2 cut(s) 86, 261
ApoI RAATTY 1 cut(s) 74
ArsI GACNNNNNNTTYG 2 cut(s) 25, 57
AvaI CYCGRG 1 cut(s) 60
BalI TGGCCA 1 cut(s) 263
BbsI GAAGAC 1 cut(s) 40
BcoDI GTCTC 1 cut(s) 234
BfaI CTAG 1 cut(s) 177
BisI GCNGC 1 cut(s) 89
BlpI GCTNAGC 1 cut(s) 5
BlsI GCNGC 1 cut(s) 90
BmeT110I CYCGRG 1 cut(s) 60
BmiI GGNNCC 1 cut(s) 387
BmsI GCATC 2 cut(s) 197, 306
BpiI GAAGAC 1 cut(s) 40
Bpu1102I GCTNAGC 1 cut(s) 5
BpuEI CTTGAG 1 cut(s) 242
BseRI GAGGAG 2 cut(s) 122, 378
BshFI GGCC 2 cut(s) 88, 263
BsiHKCI CYCGRG 1 cut(s) 60
BsmAI GTCTC 1 cut(s) 234
BsnI GGCC 2 cut(s) 88, 263
BsoBI CYCGRG 1 cut(s) 60
Bsp143I GATC 4 cut(s) 56, 81, 179, 299
Bsp1720I GCTNAGC 1 cut(s) 5
BspACI CCGC 1 cut(s) 89
BspANI GGCC 2 cut(s) 88, 263
BspHI TCATGA 1 cut(s) 352
BspLI GGNNCC 1 cut(s) 387
BspPI GGATC 1 cut(s) 64
BssMI GATC 4 cut(s) 56, 81, 179, 299
Bst4CI ACNGT 2 cut(s) 137, 213
BstDEI CTNAG 3 cut(s) 5, 38, 410
BstKTI GATC 4 cut(s) 59, 84, 182, 302
BstMAI GTCTC 1 cut(s) 234
BstMBI GATC 4 cut(s) 56, 81, 179, 299
BstNSI RCATGY 1 cut(s) 341
BstV2I GAAGAC 1 cut(s) 40
BstX2I RGATCY 1 cut(s) 56
BstYI RGATCY 1 cut(s) 56
BsuRI GGCC 2 cut(s) 88, 263
BtsIMutI CAGTG 2 cut(s) 209, 372
CciI TCATGA 1 cut(s) 352
CviAII CATG 3 cut(s) 308, 338, 353
CviJI RGCY 6 cut(s) 88, 112, 220, 263, 277, 386
CviKI_1 RGCY 6 cut(s) 88, 112, 220, 263, 277, 386
DdeI CTNAG 3 cut(s) 5, 38, 410
DpnI GATC 4 cut(s) 58, 83, 181, 301
DpnII GATC 4 cut(s) 56, 81, 179, 299
EaeI YGGCCR 2 cut(s) 86, 261
Eco32I GATATC 1 cut(s) 101
Eco57I CTGAAG 1 cut(s) 111
Eco88I CYCGRG 1 cut(s) 60
EcoRV GATATC 1 cut(s) 101
FaeI CATG 3 cut(s) 311, 341, 356
FaiI YATR 6 cut(s) 14, 16, 50, 309, 339, 354
FatI CATG 3 cut(s) 307, 337, 352
Fnu4HI GCNGC 1 cut(s) 89
Fsp4HI GCNGC 1 cut(s) 89
FspBI CTAG 1 cut(s) 177
GluI GCNGC 1 cut(s) 89
HaeIII GGCC 2 cut(s) 88, 263
Hin1II CATG 3 cut(s) 311, 341, 356
HinfI GANTC 1 cut(s) 377
Hpy166II GTNNAC 1 cut(s) 343
Hpy188I TCNGA 2 cut(s) 45, 193
Hpy188III TCNNGA 5 cut(s) 60, 104, 129, 297, 353
Hpy8I GTNNAC 1 cut(s) 343
HpyAV CCTTC 1 cut(s) 153
HpyCH4III ACNGT 2 cut(s) 137, 213
HpyCH4V TGCA 1 cut(s) 146
HpyF3I CTNAG 3 cut(s) 5, 38, 410
Hsp92II CATG 3 cut(s) 311, 341, 356
Kzo9I GATC 4 cut(s) 56, 81, 179, 299
LmnI GCTCC 2 cut(s) 109, 391
LpnPI CCDG 4 cut(s) 70, 114, 117, 201
LweI GCATC 2 cut(s) 197, 306
MaeI CTAG 1 cut(s) 177
MaeIII GTNAC 2 cut(s) 229, 393
MalI GATC 4 cut(s) 58, 83, 181, 301
MboI GATC 4 cut(s) 56, 81, 179, 299
MboII GAAGA 2 cut(s) 45, 83
MfeI CAATTG 1 cut(s) 147
MflI RGATCY 1 cut(s) 56
MlsI TGGCCA 1 cut(s) 263
MluCI AATT 3 cut(s) 74, 147, 205
MluNI TGGCCA 1 cut(s) 263
MnlI CCTC 3 cut(s) 16, 100, 399
Mox20I TGGCCA 1 cut(s) 263
MscI TGGCCA 1 cut(s) 263
MseI TTAA 1 cut(s) 197
Msp20I TGGCCA 1 cut(s) 263
MunI CAATTG 1 cut(s) 147
NdeII GATC 4 cut(s) 56, 81, 179, 299
NlaIII CATG 3 cut(s) 311, 341, 356
NlaIV GGNNCC 1 cut(s) 387
NspI RCATGY 1 cut(s) 341
PaeR7I CTCGAG 1 cut(s) 60
PagI TCATGA 1 cut(s) 352
PfeI GAWTC 1 cut(s) 377
PflFI GACNNNGTC 2 cut(s) 39, 135
PkrI GCNGC 1 cut(s) 90
PspN4I GGNNCC 1 cut(s) 387
PsuI RGATCY 1 cut(s) 56
PsyI GACNNNGTC 2 cut(s) 39, 135
SaqAI TTAA 1 cut(s) 197
SatI GCNGC 1 cut(s) 89
Sau3AI GATC 4 cut(s) 56, 81, 179, 299
SetI ASST 4 cut(s) 27, 114, 164, 416
SfaNI GCATC 2 cut(s) 197, 306
Sfr274I CTCGAG 1 cut(s) 60
SlaI CTCGAG 1 cut(s) 60
SmlI CTYRAG 2 cut(s) 60, 221
SmoI CTYRAG 2 cut(s) 60, 221
Sse9I AATT 3 cut(s) 74, 147, 205
SsiI CCGC 1 cut(s) 89
SspMI CTAG 1 cut(s) 177
TaaI ACNGT 2 cut(s) 137, 213
TaqI TCGA 1 cut(s) 61
TasI AATT 3 cut(s) 74, 147, 205
TauI GCSGC 1 cut(s) 91
TfiI GAWTC 1 cut(s) 377
Tru1I TTAA 1 cut(s) 197
Tru9I TTAA 1 cut(s) 197
TscAI CASTG 2 cut(s) 216, 379
TspDTI ATGAA 1 cut(s) 269
TspRI CASTG 2 cut(s) 216, 379
Tth111I GACNNNGTC 2 cut(s) 39, 135
XapI RAATTY 1 cut(s) 74
XceI RCATGY 1 cut(s) 341
XhoI CTCGAG 1 cut(s) 60
XspI CTAG 1 cut(s) 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.