RchiOBHm_Chr2g0125331

Nucleoside diphosphate kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
38929509 .. 38929787
279 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 210 bp
ATGAGAAGCACATGTAGACTTGAGGATGAGAATGTCATGTCAACTAGTCAAAAGATTATTGGAGCCACAAACCCTGTAGAATCTGCCCTTGGAACCATCTGTGGTGATTTTGATATTGATATTGGCAGGAAAATCATTTTTCATGGAAGTGAAGCAGTTGAGAGTTCAAGGAAAGAGATGGAACTGTGGTTCCTGATAAGAGTATTTTAA

Protein Analysis

69

Amino Acids

7.78

Weight (kDa)

4.97

Isoelectric Point (pI)

38.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NDK PF00334 6 - 64 4e-12 Nucleoside diphosphate kinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 16
AflIII ACRYGT 1 cut(s) 11
AgsI TTSAA 1 cut(s) 168
AhlI ACTAGT 1 cut(s) 44
AjuI GAANNNNNNNTTGG 2 cut(s) 72, 104
AloI GAACNNNNNNTCC 4 cut(s) 173, 174, 205, 206
AsuHPI GGTGA 1 cut(s) 116
BccI CCATC 2 cut(s) 104, 172
BcuI ACTAGT 1 cut(s) 44
BfaI CTAG 1 cut(s) 45
BfmI CTRYAG 1 cut(s) 75
BmiI GGNNCC 3 cut(s) 64, 94, 191
BpuEI CTTGAG 1 cut(s) 41
BsaJI CCNNGG 1 cut(s) 88
BseDI CCNNGG 1 cut(s) 88
BseGI GGATG 1 cut(s) 31
BspLI GGNNCC 3 cut(s) 64, 94, 191
BssECI CCNNGG 1 cut(s) 88
BssT1I CCWWGG 1 cut(s) 88
Bst4CI ACNGT 1 cut(s) 186
BstF5I GGATG 1 cut(s) 31
BstNSI RCATGY 1 cut(s) 15
BstSFI CTRYAG 1 cut(s) 75
BtsCI GGATG 1 cut(s) 31
CviAII CATG 3 cut(s) 12, 37, 143
CviJI RGCY 1 cut(s) 65
CviKI_1 RGCY 1 cut(s) 65
Eco130I CCWWGG 1 cut(s) 88
EcoT14I CCWWGG 1 cut(s) 88
ErhI CCWWGG 1 cut(s) 88
FaeI CATG 3 cut(s) 15, 40, 146
FaiI YATR 3 cut(s) 13, 38, 144
FatI CATG 3 cut(s) 11, 36, 142
FblI GTMKAC 1 cut(s) 16
FokI GGATG 1 cut(s) 38
FspBI CTAG 1 cut(s) 45
Hin1II CATG 3 cut(s) 15, 40, 146
HincII GTYRAC 1 cut(s) 42
HindII GTYRAC 1 cut(s) 42
HinfI GANTC 1 cut(s) 80
HphI GGTGA 1 cut(s) 116
Hpy166II GTNNAC 2 cut(s) 17, 42
Hpy188III TCNNGA 1 cut(s) 193
Hpy8I GTNNAC 2 cut(s) 17, 42
HpyCH4III ACNGT 1 cut(s) 186
Hsp92II CATG 3 cut(s) 15, 40, 146
LmnI GCTCC 1 cut(s) 62
LpnPI CCDG 3 cut(s) 87, 112, 206
MaeI CTAG 1 cut(s) 45
MnlI CCTC 1 cut(s) 16
MseI TTAA 1 cut(s) 208
MslI CAYNNNNRTG 1 cut(s) 147
NlaIII CATG 3 cut(s) 15, 40, 146
NlaIV GGNNCC 3 cut(s) 64, 94, 191
NspI RCATGY 1 cut(s) 15
PciI ACATGT 1 cut(s) 11
PfeI GAWTC 1 cut(s) 80
PscI ACATGT 1 cut(s) 11
PspN4I GGNNCC 3 cut(s) 64, 94, 191
RseI CAYNNNNRTG 1 cut(s) 147
SaqAI TTAA 1 cut(s) 208
SfcI CTRYAG 1 cut(s) 75
SmiMI CAYNNNNRTG 1 cut(s) 147
SmlI CTYRAG 1 cut(s) 20
SmoI CTYRAG 1 cut(s) 20
SpeI ACTAGT 1 cut(s) 44
SspMI CTAG 1 cut(s) 45
StyI CCWWGG 1 cut(s) 88
TaaI ACNGT 1 cut(s) 186
TfiI GAWTC 1 cut(s) 80
Tru1I TTAA 1 cut(s) 208
Tru9I TTAA 1 cut(s) 208
TspDTI ATGAA 1 cut(s) 131
XceI RCATGY 1 cut(s) 15
XmiI GTMKAC 1 cut(s) 16
XspI CTAG 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.