RchiOBHm_Chr1g0317171

Regulated-SNARE-like domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
4761828 .. 4761983
156 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 156 bp
ATGAAGTACTGTGTGGATCATCCTGAAGAGATCAACAAGCTTGCAAAAGTGAAGGCTCACGTTACTGAGGTCAAGGGTGTTATGATGGAAAATATTGAGAAGGTAGAAAGAGTTGCCGCTGTTAAATTCTATTTCAAATTTAGAATAGTTGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

51

Amino Acids

6.0

Weight (kDa)

9.21

Isoelectric Point (pI)

33.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 117
AclWI GGATC 1 cut(s) 24
AcsI RAATTY 2 cut(s) 125, 137
AcuI CTGAAG 1 cut(s) 45
AfaI GTAC 1 cut(s) 8
AgsI TTSAA 1 cut(s) 136
AluBI AGCT 1 cut(s) 40
AluI AGCT 1 cut(s) 40
AlwI GGATC 1 cut(s) 24
ApoI RAATTY 2 cut(s) 125, 137
BccI CCATC 1 cut(s) 79
BisI GCNGC 1 cut(s) 117
BlsI GCNGC 1 cut(s) 118
BmcAI AGTACT 1 cut(s) 8
BseGI GGATG 1 cut(s) 19
BseMII CTCAG 1 cut(s) 57
Bsp143I GATC 2 cut(s) 16, 30
BspACI CCGC 1 cut(s) 117
BspCNI CTCAG 1 cut(s) 58
BspPI GGATC 1 cut(s) 24
BssMI GATC 2 cut(s) 16, 30
Bst4CI ACNGT 1 cut(s) 11
Bst6I CTCTTC 1 cut(s) 21
BstC8I GCNNGC 1 cut(s) 42
BstDEI CTNAG 1 cut(s) 66
BstF5I GGATG 1 cut(s) 19
BstKTI GATC 2 cut(s) 19, 33
BstMBI GATC 2 cut(s) 16, 30
BtsCI GGATG 1 cut(s) 19
Cac8I GCNNGC 1 cut(s) 42
Csp6I GTAC 1 cut(s) 7
CviJI RGCY 2 cut(s) 40, 56
CviKI_1 RGCY 2 cut(s) 40, 56
CviQI GTAC 1 cut(s) 7
DdeI CTNAG 1 cut(s) 66
DpnI GATC 2 cut(s) 18, 32
DpnII GATC 2 cut(s) 16, 30
Eam1104I CTCTTC 1 cut(s) 21
EarI CTCTTC 1 cut(s) 21
Eco57I CTGAAG 1 cut(s) 45
FaiI YATR 2 cut(s) 83, 154
Fnu4HI GCNGC 1 cut(s) 117
FokI GGATG 1 cut(s) 6
Fsp4HI GCNGC 1 cut(s) 117
FspEI CC 8 cut(s) 36, 38, 53, 59, 60, 71, 86, 130
GluI GCNGC 1 cut(s) 117
HindIII AAGCTT 1 cut(s) 38
Hpy188III TCNNGA 1 cut(s) 23
HpyAV CCTTC 2 cut(s) 46, 94
HpyCH4III ACNGT 1 cut(s) 11
HpyCH4IV ACGT 1 cut(s) 60
HpyCH4V TGCA 1 cut(s) 44
HpyF3I CTNAG 1 cut(s) 66
HpySE526I ACGT 1 cut(s) 60
Kzo9I GATC 2 cut(s) 16, 30
LpnPI CCDG 1 cut(s) 36
MaeII ACGT 1 cut(s) 60
MaeIII GTNAC 1 cut(s) 61
MalI GATC 2 cut(s) 18, 32
MboI GATC 2 cut(s) 16, 30
MboII GAAGA 1 cut(s) 38
MluCI AATT 2 cut(s) 125, 137
MnlI CCTC 1 cut(s) 61
MseI TTAA 1 cut(s) 123
MspA1I CMGCKG 1 cut(s) 119
NdeII GATC 2 cut(s) 16, 30
PkrI GCNGC 1 cut(s) 118
RsaI GTAC 1 cut(s) 8
RsaNI GTAC 1 cut(s) 7
SaqAI TTAA 1 cut(s) 123
SatI GCNGC 1 cut(s) 117
Sau3AI GATC 2 cut(s) 16, 30
ScaI AGTACT 1 cut(s) 8
SetI ASST 4 cut(s) 42, 63, 72, 105
SgeI CNNG 5 cut(s) 35, 49, 53, 71, 85
Sse9I AATT 2 cut(s) 125, 137
SsiI CCGC 1 cut(s) 117
SspI AATATT 1 cut(s) 94
TaaI ACNGT 1 cut(s) 11
TaiI ACGT 1 cut(s) 63
TasI AATT 2 cut(s) 125, 137
TatI WGTACW 1 cut(s) 6
TauI GCSGC 1 cut(s) 119
Tru1I TTAA 1 cut(s) 123
Tru9I TTAA 1 cut(s) 123
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 2 cut(s) 125, 137
ZrmI AGTACT 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.