RchiOBHm_Chr1g0333681

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
25863116 .. 25863431
316 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 162 bp
ATGTCGAAGAAGGACATCTTTTCCCTGCTCTCCCGCCTCGTGCCTTTCGATGATGGCAATAAGGTGTTATGGCTGGACAGGGTCACCGGAAGGGTTTGCATGTCTATTTCTGCAAAGGCCATGGCTATAACAGGGATTGAGGATCGGCGATACTGGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

53

Amino Acids

6.11

Weight (kDa)

9.51

Isoelectric Point (pI)

68.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 34
AclWI GGATC 1 cut(s) 150
AlwI GGATC 1 cut(s) 150
AoxI GGCC 1 cut(s) 117
AsuHPI GGTGA 1 cut(s) 76
BauI CACGAG 1 cut(s) 38
BccI CCATC 1 cut(s) 47
BfaI CTAG 1 cut(s) 160
BsaJI CCNNGG 1 cut(s) 120
BsaWI WCCGGW 1 cut(s) 86
Bse1I ACTGG 1 cut(s) 158
BseDI CCNNGG 1 cut(s) 120
BseNI ACTGG 1 cut(s) 158
BshFI GGCC 1 cut(s) 119
BsiSI CCGG 1 cut(s) 87
BsnI GGCC 1 cut(s) 119
Bsp143I GATC 1 cut(s) 142
Bsp19I CCATGG 1 cut(s) 120
BspACI CCGC 1 cut(s) 34
BspANI GGCC 1 cut(s) 119
BspPI GGATC 1 cut(s) 150
BsrI ACTGG 1 cut(s) 158
BssECI CCNNGG 1 cut(s) 120
BssMI GATC 1 cut(s) 142
BssSI CACGAG 1 cut(s) 38
BssT1I CCWWGG 1 cut(s) 120
Bst2BI CACGAG 1 cut(s) 38
BstDSI CCRYGG 1 cut(s) 120
BstEII GGTNACC 1 cut(s) 82
BstKTI GATC 1 cut(s) 145
BstMBI GATC 1 cut(s) 142
BstNSI RCATGY 1 cut(s) 103
BstPI GGTNACC 1 cut(s) 82
BsuRI GGCC 1 cut(s) 119
BtgI CCRYGG 1 cut(s) 120
CviAII CATG 2 cut(s) 100, 121
CviJI RGCY 3 cut(s) 73, 119, 125
CviKI_1 RGCY 3 cut(s) 73, 119, 125
DpnI GATC 1 cut(s) 144
DpnII GATC 1 cut(s) 142
Eco130I CCWWGG 1 cut(s) 120
Eco91I GGTNACC 1 cut(s) 82
EcoO65I GGTNACC 1 cut(s) 82
EcoT14I CCWWGG 1 cut(s) 120
ErhI CCWWGG 1 cut(s) 120
FaeI CATG 2 cut(s) 103, 124
FaiI YATR 4 cut(s) 70, 101, 122, 128
FalI AAGNNNNNCTT 1 cut(s) 34
FatI CATG 2 cut(s) 99, 120
FauI CCCGC 1 cut(s) 41
FspBI CTAG 1 cut(s) 160
HaeIII GGCC 1 cut(s) 119
HapII CCGG 1 cut(s) 87
Hin1II CATG 2 cut(s) 103, 124
HpaII CCGG 1 cut(s) 87
HphI GGTGA 1 cut(s) 76
HpyAV CCTTC 2 cut(s) 4, 84
HpyCH4V TGCA 2 cut(s) 99, 113
Hsp92II CATG 2 cut(s) 103, 124
Kzo9I GATC 1 cut(s) 142
LpnPI CCDG 6 cut(s) 38, 59, 64, 100, 117, 139
MaeI CTAG 1 cut(s) 160
MaeIII GTNAC 1 cut(s) 82
MalI GATC 1 cut(s) 144
MboI GATC 1 cut(s) 142
MboII GAAGA 1 cut(s) 19
MnlI CCTC 2 cut(s) 47, 133
MspI CCGG 1 cut(s) 87
NcoI CCATGG 1 cut(s) 120
NdeII GATC 1 cut(s) 142
NlaIII CATG 2 cut(s) 103, 124
NmuCI GTSAC 1 cut(s) 82
NspI RCATGY 1 cut(s) 103
PcsI WCGNNNNNNNCGW 1 cut(s) 45
PflFI GACNNNGTC 1 cut(s) 80
PspEI GGTNACC 1 cut(s) 82
PsyI GACNNNGTC 1 cut(s) 80
Sau3AI GATC 1 cut(s) 142
SetI ASST 1 cut(s) 66
SsiI CCGC 1 cut(s) 34
SspMI CTAG 1 cut(s) 160
StyI CCWWGG 1 cut(s) 120
TaqI TCGA 2 cut(s) 5, 48
TseFI GTSAC 1 cut(s) 82
Tsp45I GTSAC 1 cut(s) 82
Tth111I GACNNNGTC 1 cut(s) 80
XceI RCATGY 1 cut(s) 103
XspI CTAG 1 cut(s) 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.