RchiOBHm_Chr1g0370471

Synaptotagmin-3-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
59963543 .. 59966173
2631 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 138 bp
ATGGCACAAACTATCTTTACAGAATACATTAAGGCAATTGAATTCGGCGAACTGAGTCTTGGAACTCTACCACCCATAATATATGGAGACCATCAAAAGACAAGTCGCAAGCCTCTACCTCTGGCCTTAAAGACTTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

45

Amino Acids

5.03

Weight (kDa)

8.12

Isoelectric Point (pI)

32.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 41
AgsI TTSAA 1 cut(s) 41
AjuI GAANNNNNNNTTGG 2 cut(s) 42, 74
Alw26I GTCTC 1 cut(s) 81
AoxI GGCC 1 cut(s) 123
ApoI RAATTY 1 cut(s) 41
ArsI GACNNNNNNTTYG 2 cut(s) 88, 120
BccI CCATC 1 cut(s) 99
BcoDI GTCTC 1 cut(s) 81
BsaI GGTCTC 1 cut(s) 81
BseMII CTCAG 1 cut(s) 44
BshFI GGCC 1 cut(s) 125
BsmAI GTCTC 1 cut(s) 81
BsnI GGCC 1 cut(s) 125
Bso31I GGTCTC 1 cut(s) 81
BspANI GGCC 1 cut(s) 125
BspCNI CTCAG 1 cut(s) 45
BspTNI GGTCTC 1 cut(s) 81
BstC8I GCNNGC 1 cut(s) 110
BstDEI CTNAG 1 cut(s) 53
BstMAI GTCTC 1 cut(s) 81
BsuRI GGCC 1 cut(s) 125
Cac8I GCNNGC 1 cut(s) 110
CviJI RGCY 2 cut(s) 112, 125
CviKI_1 RGCY 2 cut(s) 112, 125
DdeI CTNAG 1 cut(s) 53
Eco31I GGTCTC 1 cut(s) 81
EcoRI GAATTC 1 cut(s) 41
FaiI YATR 3 cut(s) 77, 82, 84
HaeIII GGCC 1 cut(s) 125
HinfI GANTC 1 cut(s) 55
HpyF3I CTNAG 1 cut(s) 53
LpnPI CCDG 1 cut(s) 107
MfeI CAATTG 1 cut(s) 36
MluCI AATT 2 cut(s) 36, 41
MlyI GAGTC 1 cut(s) 64
MnlI CCTC 2 cut(s) 123, 129
MseI TTAA 2 cut(s) 30, 128
MunI CAATTG 1 cut(s) 36
PleI GAGTC 1 cut(s) 63
PpsI GAGTC 1 cut(s) 63
SaqAI TTAA 2 cut(s) 30, 128
SchI GAGTC 1 cut(s) 64
SetI ASST 1 cut(s) 121
SgeI CNNG 4 cut(s) 71, 114, 121, 134
Sse9I AATT 2 cut(s) 36, 41
TasI AATT 2 cut(s) 36, 41
Tru1I TTAA 2 cut(s) 30, 128
Tru9I TTAA 2 cut(s) 30, 128
XapI RAATTY 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.