Rh6BG044600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Reverse (-)
7078208 .. 7078783
576 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG044600.1

Sequence Viewer

Length: 177 bp
ATGCAAGTCGCAAGCCTCTACCTCTGGCCTCAAAGACTTGATATCCCTACCTTCAACGTCGAATATGGACCTTCAAGCACTTTGGGTCCGATCATTGTACTACATGGGCGAGTTGAGGTAGGCTTGTATGATCAGGCTTCATTGATCTTATTTTACTTACTAGTATTAAGCTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.49

Weight (kDa)

4.75

Isoelectric Point (pI)

33.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 99
AgsI TTSAA 2 cut(s) 55, 75
AhlI ACTAGT 1 cut(s) 160
AluBI AGCT 1 cut(s) 171
AluI AGCT 1 cut(s) 171
AoxI GGCC 1 cut(s) 26
AspS9I GGNCC 2 cut(s) 68, 86
AvaII GGWCC 2 cut(s) 68, 86
BclI TGATCA 1 cut(s) 130
BcuI ACTAGT 1 cut(s) 160
BfaI CTAG 1 cut(s) 161
Bme18I GGWCC 2 cut(s) 68, 86
BmgT120I GGNCC 2 cut(s) 68, 86
BmiI GGNNCC 1 cut(s) 87
BshFI GGCC 1 cut(s) 28
BsnI GGCC 1 cut(s) 28
Bsp143I GATC 3 cut(s) 90, 130, 144
BspANI GGCC 1 cut(s) 28
BspHI TCATGA 1 cut(s) 173
BspLI GGNNCC 1 cut(s) 87
BssMI GATC 3 cut(s) 90, 130, 144
BstC8I GCNNGC 1 cut(s) 13
BstKTI GATC 3 cut(s) 93, 133, 147
BstMBI GATC 3 cut(s) 90, 130, 144
BsuRI GGCC 1 cut(s) 28
Cac8I GCNNGC 1 cut(s) 13
CciI TCATGA 1 cut(s) 173
Cfr13I GGNCC 2 cut(s) 68, 86
Csp6I GTAC 1 cut(s) 98
CviAII CATG 2 cut(s) 104, 174
CviJI RGCY 5 cut(s) 15, 28, 123, 137, 171
CviKI_1 RGCY 5 cut(s) 15, 28, 123, 137, 171
CviQI GTAC 1 cut(s) 98
DpnI GATC 3 cut(s) 92, 132, 146
DpnII GATC 3 cut(s) 90, 130, 144
Eco32I GATATC 1 cut(s) 43
Eco47I GGWCC 2 cut(s) 68, 86
EcoRV GATATC 1 cut(s) 43
FaeI CATG 2 cut(s) 107, 177
FaiI YATR 4 cut(s) 66, 105, 129, 175
FatI CATG 2 cut(s) 103, 173
FbaI TGATCA 1 cut(s) 130
FspBI CTAG 1 cut(s) 161
HaeIII GGCC 1 cut(s) 28
Hin1II CATG 2 cut(s) 107, 177
Hpy188I TCNGA 1 cut(s) 90
Hpy188III TCNNGA 1 cut(s) 174
Hpy99I CGWCG 1 cut(s) 62
HpyAV CCTTC 2 cut(s) 61, 81
HpyCH4IV ACGT 1 cut(s) 57
HpyCH4V TGCA 1 cut(s) 4
HpySE526I ACGT 1 cut(s) 57
Hsp92II CATG 2 cut(s) 107, 177
Ksp22I TGATCA 1 cut(s) 130
Kzo9I GATC 3 cut(s) 90, 130, 144
LpnPI CCDG 2 cut(s) 10, 119
MaeI CTAG 1 cut(s) 161
MaeII ACGT 1 cut(s) 57
MalI GATC 3 cut(s) 92, 132, 146
MboI GATC 3 cut(s) 90, 130, 144
MnlI CCTC 4 cut(s) 26, 32, 39, 109
MseI TTAA 1 cut(s) 167
NdeII GATC 3 cut(s) 90, 130, 144
NlaIII CATG 2 cut(s) 107, 177
NlaIV GGNNCC 1 cut(s) 87
PagI TCATGA 1 cut(s) 173
PspN4I GGNNCC 1 cut(s) 87
PspPI GGNCC 2 cut(s) 68, 86
RsaI GTAC 1 cut(s) 99
RsaNI GTAC 1 cut(s) 98
SaqAI TTAA 1 cut(s) 167
Sau3AI GATC 3 cut(s) 90, 130, 144
Sau96I GGNCC 2 cut(s) 68, 86
SetI ASST 6 cut(s) 24, 53, 60, 73, 120, 173
SinI GGWCC 2 cut(s) 68, 86
SpeI ACTAGT 1 cut(s) 160
SspMI CTAG 1 cut(s) 161
TaiI ACGT 1 cut(s) 60
TaqI TCGA 1 cut(s) 60
TatI WGTACW 1 cut(s) 97
Tru1I TTAA 1 cut(s) 167
Tru9I TTAA 1 cut(s) 167
TspDTI ATGAA 1 cut(s) 129
VpaK11BI GGWCC 2 cut(s) 68, 86
XspI CTAG 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.