RchiOBHm_Chr7g0238251
ERF Family

Performs the first committed step in the biosynthesis of isoprene-containing compounds such as sterols and terpenoids

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
63615208 .. 63615674
467 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21350

Sequence Viewer

Length: 129 bp
ATGATCTCTAACTCTTTGTTTGTACTTGCAGTTTTTGCCCTTGGAAAGTTAATGAATAAAAAGGAAGATCAGAGTCAGCTTTCTGCAATTGCAAGGCAAGGTTCAGGCAGTGCTTTAGAGGAGACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Pfam Domains
Protein Families

Protein Analysis

42

Amino Acids

4.48

Weight (kDa)

6.01

Isoelectric Point (pI)

43.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 24
AluBI AGCT 1 cut(s) 79
AluI AGCT 1 cut(s) 79
Alw26I GTCTC 1 cut(s) 116
BcoDI GTCTC 1 cut(s) 116
BsaJI CCNNGG 1 cut(s) 40
BseDI CCNNGG 1 cut(s) 40
BsmAI GTCTC 1 cut(s) 116
Bsp143I GATC 2 cut(s) 3, 67
BssECI CCNNGG 1 cut(s) 40
BssMI GATC 2 cut(s) 3, 67
BssT1I CCWWGG 1 cut(s) 40
BstAPI GCANNNNNTGC 1 cut(s) 35
BstKTI GATC 2 cut(s) 6, 70
BstMAI GTCTC 1 cut(s) 116
BstMBI GATC 2 cut(s) 3, 67
BstMWI GCNNNNNNNGC 1 cut(s) 35
BtsI GCAGTG 1 cut(s) 115
BtsIMutI CAGTG 1 cut(s) 115
Csp6I GTAC 1 cut(s) 23
CviJI RGCY 1 cut(s) 79
CviKI_1 RGCY 1 cut(s) 79
CviQI GTAC 1 cut(s) 23
DpnI GATC 2 cut(s) 5, 69
DpnII GATC 2 cut(s) 3, 67
Eco130I CCWWGG 1 cut(s) 40
EcoT14I CCWWGG 1 cut(s) 40
ErhI CCWWGG 1 cut(s) 40
FspEI CC 8 cut(s) 27, 47, 52, 53, 79, 84, 90, 104
HinfI GANTC 1 cut(s) 73
Hpy188I TCNGA 1 cut(s) 72
HpyCH4V TGCA 3 cut(s) 29, 86, 92
HpyF10VI GCNNNNNNNGC 1 cut(s) 35
Kzo9I GATC 2 cut(s) 3, 67
LpnPI CCDG 1 cut(s) 90
MalI GATC 2 cut(s) 5, 69
MboI GATC 2 cut(s) 3, 67
MboII GAAGA 1 cut(s) 77
MfeI CAATTG 1 cut(s) 87
MluCI AATT 1 cut(s) 87
MlyI GAGTC 1 cut(s) 82
MnlI CCTC 1 cut(s) 112
MseI TTAA 1 cut(s) 50
MunI CAATTG 1 cut(s) 87
MwoI GCNNNNNNNGC 1 cut(s) 35
NdeII GATC 2 cut(s) 3, 67
PleI GAGTC 1 cut(s) 81
PpsI GAGTC 1 cut(s) 81
RsaI GTAC 1 cut(s) 24
RsaNI GTAC 1 cut(s) 23
SaqAI TTAA 1 cut(s) 50
Sau3AI GATC 2 cut(s) 3, 67
SchI GAGTC 1 cut(s) 82
SetI ASST 2 cut(s) 81, 103
SgeI CNNG 5 cut(s) 38, 53, 105, 110, 117
Sse9I AATT 1 cut(s) 87
StyI CCWWGG 1 cut(s) 40
TasI AATT 1 cut(s) 87
TatI WGTACW 1 cut(s) 22
Tru1I TTAA 1 cut(s) 50
Tru9I TTAA 1 cut(s) 50
TscAI CASTG 1 cut(s) 115
TspDTI ATGAA 1 cut(s) 68
TspRI CASTG 1 cut(s) 115
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.