Rroxscaffold_7G00170930

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
11340422 .. 11343714
3293 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00170930.1

Sequence Viewer

Length: 186 bp
ATGCAGACAAGGTTCAGGCAGTGCTTTAGAGGAGACTTTGAAGTGCCAATTATATATCAGCTTTATTTAGCAGCAGAGGTATTGGATTATATGGCTGAGAGCTTAAGAAAGATGATGAAGTGTGGCTGGTCAGGGGAGCAGTTTAGAGCACTAGATGATCTGGTATTTTCAGATTATGTGGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

7.3

Weight (kDa)

4.69

Isoelectric Point (pI)

31.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflII CTTAAG 1 cut(s) 103
AgsI TTSAA 1 cut(s) 41
AluBI AGCT 2 cut(s) 61, 102
AluI AGCT 2 cut(s) 61, 102
Alw21I GWGCWC 1 cut(s) 151
Alw26I GTCTC 1 cut(s) 27
ApeKI GCWGC 1 cut(s) 71
Bbv12I GWGCWC 1 cut(s) 151
BbvI GCAGC 1 cut(s) 83
BcoDI GTCTC 1 cut(s) 27
BfaI CTAG 1 cut(s) 152
BfrI CTTAAG 1 cut(s) 103
BisI GCNGC 1 cut(s) 72
BlsI GCNGC 1 cut(s) 73
BseMII CTCAG 1 cut(s) 87
BseRI GAGGAG 1 cut(s) 45
BseXI GCAGC 1 cut(s) 83
BsiHKAI GWGCWC 1 cut(s) 151
BsmAI GTCTC 1 cut(s) 27
Bsp1286I GDGCHC 1 cut(s) 151
Bsp143I GATC 1 cut(s) 157
BspCNI CTCAG 1 cut(s) 88
BspTI CTTAAG 1 cut(s) 103
BssMI GATC 1 cut(s) 157
BstAFI CTTAAG 1 cut(s) 103
BstDEI CTNAG 1 cut(s) 96
BstKTI GATC 1 cut(s) 160
BstMAI GTCTC 1 cut(s) 27
BstMBI GATC 1 cut(s) 157
BstV1I GCAGC 1 cut(s) 83
BtsI GCAGTG 1 cut(s) 26
BtsIMutI CAGTG 1 cut(s) 26
CviJI RGCY 4 cut(s) 61, 95, 102, 126
CviKI_1 RGCY 4 cut(s) 61, 95, 102, 126
DdeI CTNAG 1 cut(s) 96
DpnI GATC 1 cut(s) 159
DpnII GATC 1 cut(s) 157
FaiI YATR 5 cut(s) 53, 55, 90, 92, 177
Fnu4HI GCNGC 1 cut(s) 72
Fsp4HI GCNGC 1 cut(s) 72
FspBI CTAG 1 cut(s) 152
GluI GCNGC 1 cut(s) 72
Hpy188I TCNGA 1 cut(s) 172
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 1 cut(s) 96
Kzo9I GATC 1 cut(s) 157
LmnI GCTCC 1 cut(s) 136
LpnPI CCDG 3 cut(s) 112, 117, 146
Lsp1109I GCAGC 1 cut(s) 83
MaeI CTAG 1 cut(s) 152
MalI GATC 1 cut(s) 159
MboI GATC 1 cut(s) 157
MhlI GDGCHC 1 cut(s) 151
MluCI AATT 1 cut(s) 48
MnlI CCTC 2 cut(s) 23, 70
MseI TTAA 2 cut(s) 104, 184
MspCI CTTAAG 1 cut(s) 103
NdeII GATC 1 cut(s) 157
PkrI GCNGC 1 cut(s) 73
SaqAI TTAA 2 cut(s) 104, 184
SatI GCNGC 1 cut(s) 72
Sau3AI GATC 1 cut(s) 157
SduI GDGCHC 1 cut(s) 151
SetI ASST 4 cut(s) 14, 63, 81, 104
SgeI CNNG 6 cut(s) 21, 28, 139, 144, 164, 173
SmlI CTYRAG 1 cut(s) 103
SmoI CTYRAG 1 cut(s) 103
Sse9I AATT 1 cut(s) 48
SspMI CTAG 1 cut(s) 152
TasI AATT 1 cut(s) 48
Tru1I TTAA 2 cut(s) 104, 184
Tru9I TTAA 2 cut(s) 104, 184
TscAI CASTG 1 cut(s) 26
TseI GCWGC 1 cut(s) 71
TspDTI ATGAA 1 cut(s) 131
TspRI CASTG 1 cut(s) 26
Vha464I CTTAAG 1 cut(s) 103
XspI CTAG 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.