RchiOBHm_Chr2g0089841

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
3908560 .. 3911490
2931 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ46514

Sequence Viewer

Length: 159 bp
ATGCTGGGTTTTAATTTGAAATTTCCTTTGAAATTTGATTTGTTTTCGATGGTTTATGGTCGAATTGGGGATACGGGGTTATCAAATATAAGAAATTGGTGTTTTCTGTCGCTGAGCTCAACAACCAATTTCAGAAGAAGCTGGTGTTTCAGATCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

6.13

Weight (kDa)

10.3

Isoelectric Point (pI)

39.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 147
AcsI RAATTY 2 cut(s) 20, 32
AgsI TTSAA 2 cut(s) 19, 31
AluBI AGCT 2 cut(s) 117, 141
AluI AGCT 2 cut(s) 117, 141
Alw21I GWGCWC 1 cut(s) 119
AlwI GGATC 1 cut(s) 147
AlwNI CAGNNNCTG 1 cut(s) 156
ApoI RAATTY 2 cut(s) 20, 32
BanII GRGCYC 1 cut(s) 119
Bbv12I GWGCWC 1 cut(s) 119
BccI CCATC 1 cut(s) 43
BciVI GTATCC 1 cut(s) 64
BfuI GTATCC 1 cut(s) 64
BlpI GCTNAGC 1 cut(s) 113
Bpu1102I GCTNAGC 1 cut(s) 113
BseMII CTCAG 1 cut(s) 104
BseYI CCCAGC 1 cut(s) 4
BsiHKAI GWGCWC 1 cut(s) 119
Bsp1286I GDGCHC 1 cut(s) 119
Bsp143I GATC 1 cut(s) 152
Bsp1720I GCTNAGC 1 cut(s) 113
BspCNI CTCAG 1 cut(s) 105
BspPI GGATC 1 cut(s) 147
BssMI GATC 1 cut(s) 152
BstDEI CTNAG 1 cut(s) 113
BstKTI GATC 1 cut(s) 155
BstMBI GATC 1 cut(s) 152
BstX2I RGATCY 1 cut(s) 152
BstYI RGATCY 1 cut(s) 152
BsuI GTATCC 1 cut(s) 64
CaiI CAGNNNCTG 1 cut(s) 156
CviJI RGCY 2 cut(s) 117, 141
CviKI_1 RGCY 2 cut(s) 117, 141
DdeI CTNAG 1 cut(s) 113
DpnI GATC 1 cut(s) 154
DpnII GATC 1 cut(s) 152
Ecl136II GAGCTC 1 cut(s) 117
Eco24I GRGCYC 1 cut(s) 119
Eco53kI GAGCTC 1 cut(s) 117
EcoICRI GAGCTC 1 cut(s) 117
EcoT38I GRGCYC 1 cut(s) 119
FaiI YATR 2 cut(s) 57, 89
FriOI GRGCYC 1 cut(s) 119
GsaI CCCAGC 1 cut(s) 8
Hpy188I TCNGA 2 cut(s) 134, 152
Hpy188III TCNNGA 1 cut(s) 156
HpyF3I CTNAG 1 cut(s) 113
Kzo9I GATC 1 cut(s) 152
LpnPI CCDG 1 cut(s) 127
MalI GATC 1 cut(s) 154
MboI GATC 1 cut(s) 152
MboII GAAGA 1 cut(s) 147
MflI RGATCY 1 cut(s) 152
MhlI GDGCHC 1 cut(s) 119
MluCI AATT 6 cut(s) 13, 20, 32, 63, 94, 127
MseI TTAA 1 cut(s) 12
NdeII GATC 1 cut(s) 152
Psp124BI GAGCTC 1 cut(s) 119
PspFI CCCAGC 1 cut(s) 4
PstNI CAGNNNCTG 1 cut(s) 156
PsuI RGATCY 1 cut(s) 152
SacI GAGCTC 1 cut(s) 119
SaqAI TTAA 1 cut(s) 12
Sau3AI GATC 1 cut(s) 152
SduI GDGCHC 1 cut(s) 119
SetI ASST 2 cut(s) 119, 143
SgeI CNNG 3 cut(s) 17, 87, 154
Sse9I AATT 6 cut(s) 13, 20, 32, 63, 94, 127
SstI GAGCTC 1 cut(s) 119
TaqI TCGA 2 cut(s) 47, 61
TasI AATT 6 cut(s) 13, 20, 32, 63, 94, 127
Tru1I TTAA 1 cut(s) 12
Tru9I TTAA 1 cut(s) 12
XapI RAATTY 2 cut(s) 20, 32
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.