Rh1DG057200
ERF Family

Performs the first committed step in the biosynthesis of isoprene-containing compounds such as sterols and terpenoids

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
9311049 .. 9313448
2400 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG057200.1

Sequence Viewer

Length: 309 bp
ATGCTCTGCGCCTCTGGTTACAGGAAGTGCTATTGGAGTTGTATCAACTGCTGGACTTGCGTGGAAATATTCAAGGAGTTTGCATGTGCACGATGTATCGCTGGCTTTGCTTATCTCGTTTTTGCCCTTGGAAAGTTAATGAATAAAAAGGAAGATCAGAGTCAGCTTTCTGCAATTGCAAGGCAGTGCTTCAGAGGAGACTTGAAAGTGCCAATCATATATCAGCTTTATTTAGCAAAGGTATTGGATTATGTGGCTGGTCGAAAGCTTAAGAAAGATGAAGTGTGGCTAGTCGAGAGAGCAGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

11.77

Weight (kDa)

9.07

Isoelectric Point (pI)

22.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 175
AflII CTTAAG 1 cut(s) 269
AgsI TTSAA 2 cut(s) 73, 205
AluBI AGCT 3 cut(s) 166, 226, 268
AluI AGCT 3 cut(s) 166, 226, 268
Alw21I GWGCWC 1 cut(s) 91
Alw26I GTCTC 1 cut(s) 192
Alw44I GTGCAC 1 cut(s) 87
ApaLI GTGCAC 1 cut(s) 87
AspLEI GCGC 1 cut(s) 11
BaeGI GKGCMC 1 cut(s) 91
Bbv12I GWGCWC 1 cut(s) 91
BcoDI GTCTC 1 cut(s) 192
BfaI CTAG 1 cut(s) 290
BfrI CTTAAG 1 cut(s) 269
BsaJI CCNNGG 1 cut(s) 127
BseDI CCNNGG 1 cut(s) 127
BseRI GAGGAG 1 cut(s) 210
BseSI GKGCMC 1 cut(s) 91
BsiHKAI GWGCWC 1 cut(s) 91
BsmAI GTCTC 1 cut(s) 192
Bsp1286I GDGCHC 1 cut(s) 91
Bsp143I GATC 1 cut(s) 154
BspTI CTTAAG 1 cut(s) 269
BssECI CCNNGG 1 cut(s) 127
BssMI GATC 1 cut(s) 154
BssT1I CCWWGG 1 cut(s) 127
BstAFI CTTAAG 1 cut(s) 269
BstC8I GCNNGC 1 cut(s) 103
BstHHI GCGC 1 cut(s) 11
BstKTI GATC 1 cut(s) 157
BstMAI GTCTC 1 cut(s) 192
BstMBI GATC 1 cut(s) 154
BstMWI GCNNNNNNNGC 2 cut(s) 57, 107
BstNSI RCATGY 1 cut(s) 87
BstSLI GKGCMC 1 cut(s) 91
BtsI GCAGTG 1 cut(s) 191
BtsIMutI CAGTG 1 cut(s) 191
Cac8I GCNNGC 1 cut(s) 103
CfoI GCGC 1 cut(s) 11
CviAII CATG 1 cut(s) 84
CviJI RGCY 6 cut(s) 105, 166, 226, 257, 268, 289
CviKI_1 RGCY 6 cut(s) 105, 166, 226, 257, 268, 289
DpnI GATC 1 cut(s) 156
DpnII GATC 1 cut(s) 154
Eco130I CCWWGG 1 cut(s) 127
Eco57I CTGAAG 1 cut(s) 175
EcoT14I CCWWGG 1 cut(s) 127
ErhI CCWWGG 1 cut(s) 127
FaeI CATG 1 cut(s) 87
FaiI YATR 4 cut(s) 85, 218, 220, 252
FatI CATG 1 cut(s) 83
FspBI CTAG 1 cut(s) 290
GlaI GCGC 1 cut(s) 10
HhaI GCGC 1 cut(s) 11
Hin1II CATG 1 cut(s) 87
Hin6I GCGC 1 cut(s) 9
HinP1I GCGC 1 cut(s) 9
HindIII AAGCTT 1 cut(s) 266
HinfI GANTC 1 cut(s) 160
Hpy166II GTNNAC 1 cut(s) 89
Hpy188I TCNGA 2 cut(s) 159, 194
Hpy188III TCNNGA 1 cut(s) 295
Hpy8I GTNNAC 1 cut(s) 89
HpyCH4V TGCA 4 cut(s) 83, 89, 173, 179
HpyF10VI GCNNNNNNNGC 2 cut(s) 57, 107
Hsp92II CATG 1 cut(s) 87
HspAI GCGC 1 cut(s) 9
Kzo9I GATC 1 cut(s) 154
LpnPI CCDG 4 cut(s) 7, 37, 87, 243
MaeI CTAG 1 cut(s) 290
MaeIII GTNAC 1 cut(s) 17
MalI GATC 1 cut(s) 156
MboI GATC 1 cut(s) 154
MboII GAAGA 1 cut(s) 164
MfeI CAATTG 1 cut(s) 174
MhlI GDGCHC 1 cut(s) 91
MluCI AATT 1 cut(s) 174
MlyI GAGTC 1 cut(s) 169
MnlI CCTC 2 cut(s) 22, 188
MseI TTAA 2 cut(s) 137, 270
MspCI CTTAAG 1 cut(s) 269
MunI CAATTG 1 cut(s) 174
MwoI GCNNNNNNNGC 2 cut(s) 57, 107
NdeII GATC 1 cut(s) 154
NlaIII CATG 1 cut(s) 87
NspI RCATGY 1 cut(s) 87
PleI GAGTC 1 cut(s) 168
PpsI GAGTC 1 cut(s) 168
SaqAI TTAA 2 cut(s) 137, 270
Sau3AI GATC 1 cut(s) 154
SchI GAGTC 1 cut(s) 169
SduI GDGCHC 1 cut(s) 91
SetI ASST 4 cut(s) 168, 228, 243, 270
SmlI CTYRAG 1 cut(s) 269
SmoI CTYRAG 1 cut(s) 269
Sse9I AATT 1 cut(s) 174
SspI AATATT 1 cut(s) 69
SspMI CTAG 1 cut(s) 290
StyI CCWWGG 1 cut(s) 127
TaqI TCGA 2 cut(s) 262, 294
TasI AATT 1 cut(s) 174
Tru1I TTAA 2 cut(s) 137, 270
Tru9I TTAA 2 cut(s) 137, 270
TscAI CASTG 1 cut(s) 191
TspDTI ATGAA 2 cut(s) 155, 294
TspRI CASTG 1 cut(s) 191
Vha464I CTTAAG 1 cut(s) 269
VneI GTGCAC 1 cut(s) 87
XceI RCATGY 1 cut(s) 87
XspI CTAG 1 cut(s) 290
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.