RchiOBHm_Chr1g0329401

protein serine/threonine kinase activity

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
18982581 .. 18983330
750 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55872

Sequence Viewer

Length: 357 bp
ATGAGAATATATTTGCTTTCTTTACCAGAAAGTAACAAATCATTATGCTCCCTTCTGATAGTTCTTTCATTTTCATTTTTTCTGTGTGTTGAAGGCTATTTAACCGGCAAAAATGATGTGTGTGATTTTGGAGTTGTTATGCTCGAATTGTTGACTGGAAAACTAGTTATTGACACCAATCGGCCAACCAGGGAACAAGATCTAGTTGAATGGGCCAAACCATACCTTGCCAGCAAATACCTCACAGGTACTTCCCGCTATGCAAGTGTTAACACTCATCTTGGAATTGAACAAAGCAGAAGGGATGATCTGGAATCACTTGGTTATGTGGTTATGTATTTCCTAAGAGGAAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

118

Amino Acids

13.45

Weight (kDa)

6.56

Isoelectric Point (pI)

30.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 256
AcoI YGGCCR 1 cut(s) 182
AfaI GTAC 1 cut(s) 250
AgsI TTSAA 3 cut(s) 92, 209, 290
AhlI ACTAGT 1 cut(s) 163
AjnI CCWGG 1 cut(s) 188
AoxI GGCC 2 cut(s) 182, 213
AspS9I GGNCC 1 cut(s) 213
BciT130I CCWGG 1 cut(s) 190
BcuI ACTAGT 1 cut(s) 163
BfaI CTAG 2 cut(s) 164, 203
BglII AGATCT 1 cut(s) 199
Bme1390I CCNGG 1 cut(s) 190
BmgT120I GGNCC 1 cut(s) 213
BmrFI CCNGG 1 cut(s) 190
BsaJI CCNNGG 1 cut(s) 189
Bse118I RCCGGY 1 cut(s) 104
Bse1I ACTGG 1 cut(s) 160
BseBI CCWGG 1 cut(s) 190
BseDI CCNNGG 1 cut(s) 189
BseGI GGATG 1 cut(s) 310
BseNI ACTGG 1 cut(s) 160
BshFI GGCC 2 cut(s) 184, 215
BsiSI CCGG 1 cut(s) 105
BsnI GGCC 2 cut(s) 184, 215
Bsp143I GATC 2 cut(s) 199, 307
BspACI CCGC 1 cut(s) 256
BspANI GGCC 2 cut(s) 184, 215
BsrFI RCCGGY 1 cut(s) 104
BsrI ACTGG 1 cut(s) 160
BssAI RCCGGY 1 cut(s) 104
BssECI CCNNGG 1 cut(s) 189
BssMI GATC 2 cut(s) 199, 307
Bst2UI CCWGG 1 cut(s) 190
BstC8I GCNNGC 1 cut(s) 232
BstDEI CTNAG 1 cut(s) 344
BstF5I GGATG 1 cut(s) 310
BstKTI GATC 2 cut(s) 202, 310
BstMBI GATC 2 cut(s) 199, 307
BstNI CCWGG 1 cut(s) 190
BstSCI CCNGG 1 cut(s) 188
BstX2I RGATCY 1 cut(s) 199
BstYI RGATCY 1 cut(s) 199
BsuRI GGCC 2 cut(s) 184, 215
BtsCI GGATG 1 cut(s) 310
Cac8I GCNNGC 1 cut(s) 232
Cfr10I RCCGGY 1 cut(s) 104
Cfr13I GGNCC 1 cut(s) 213
Csp6I GTAC 1 cut(s) 249
CviJI RGCY 3 cut(s) 96, 184, 215
CviKI_1 RGCY 3 cut(s) 96, 184, 215
CviQI GTAC 1 cut(s) 249
DdeI CTNAG 1 cut(s) 344
DpnI GATC 2 cut(s) 201, 309
DpnII GATC 2 cut(s) 199, 307
EaeI YGGCCR 1 cut(s) 182
EcoRII CCWGG 1 cut(s) 188
FaiI YATR 7 cut(s) 10, 46, 140, 223, 261, 327, 335
FauI CCCGC 1 cut(s) 263
FokI GGATG 1 cut(s) 317
FspBI CTAG 2 cut(s) 164, 203
HaeIII GGCC 2 cut(s) 184, 215
HapII CCGG 1 cut(s) 105
HincII GTYRAC 2 cut(s) 153, 271
HindII GTYRAC 2 cut(s) 153, 271
HinfI GANTC 1 cut(s) 314
HpaI GTTAAC 1 cut(s) 271
HpaII CCGG 1 cut(s) 105
Hpy166II GTNNAC 2 cut(s) 153, 271
Hpy188I TCNGA 1 cut(s) 57
Hpy188III TCNNGA 1 cut(s) 311
Hpy8I GTNNAC 2 cut(s) 153, 271
HpyAV CCTTC 4 cut(s) 62, 86, 294, 345
HpyCH4V TGCA 1 cut(s) 263
HpyF3I CTNAG 1 cut(s) 344
KspAI GTTAAC 1 cut(s) 271
Kzo9I GATC 2 cut(s) 199, 307
LmnI GCTCC 1 cut(s) 53
LpnPI CCDG 8 cut(s) 39, 118, 141, 175, 202, 231, 244, 296
MaeI CTAG 2 cut(s) 164, 203
MaeIII GTNAC 1 cut(s) 32
MalI GATC 2 cut(s) 201, 309
MboI GATC 2 cut(s) 199, 307
MflI RGATCY 1 cut(s) 199
MluCI AATT 2 cut(s) 146, 285
MnlI CCTC 2 cut(s) 251, 341
MseI TTAA 2 cut(s) 101, 270
MspI CCGG 1 cut(s) 105
MspR9I CCNGG 1 cut(s) 190
MvaI CCWGG 1 cut(s) 190
NdeII GATC 2 cut(s) 199, 307
PfeI GAWTC 1 cut(s) 314
Psp6I CCWGG 1 cut(s) 188
PspGI CCWGG 1 cut(s) 188
PspPI GGNCC 1 cut(s) 213
PsuI RGATCY 1 cut(s) 199
RsaI GTAC 1 cut(s) 250
RsaNI GTAC 1 cut(s) 249
SaqAI TTAA 2 cut(s) 101, 270
Sau3AI GATC 2 cut(s) 199, 307
Sau96I GGNCC 1 cut(s) 213
ScrFI CCNGG 1 cut(s) 190
SetI ASST 4 cut(s) 228, 243, 250, 356
SpeI ACTAGT 1 cut(s) 163
Sse9I AATT 2 cut(s) 146, 285
SsiI CCGC 1 cut(s) 256
SspMI CTAG 2 cut(s) 164, 203
StyD4I CCNGG 1 cut(s) 188
TaqI TCGA 1 cut(s) 144
TasI AATT 2 cut(s) 146, 285
TfiI GAWTC 1 cut(s) 314
Tru1I TTAA 2 cut(s) 101, 270
Tru9I TTAA 2 cut(s) 101, 270
TspDTI ATGAA 2 cut(s) 57, 63
XspI CTAG 2 cut(s) 164, 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.