Rh5DG462600

protein serine/threonine kinase activity

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
73354161 .. 73354626
466 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG462600.1

Sequence Viewer

Length: 315 bp
ATGAGAATATATTTGTTTTCTTTACCAGAAAGTAACAAATCATTATGCTCCCTTCTGATAATTCTTTCATTTTCATTTTTTCTGTGTGCTGAAGGTCATTTAACCGGCAAAAATGATGTGTGTGATTTTGGAGTTGTTATGCTCGAATTGTTGACTGGAAAACCAGTTATTGACACCAATCGACCAACCAGGGAACAGGATCTAGTTGAATGGGTCAAACTATACCTTGCCAGCAAATACCTCACAGAACAAAGCAGAAGGGATAATCTGGAATCACTTGGTTCTGTGGTTATGTATTTCCTAAGAGGAAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

104

Amino Acids

11.94

Weight (kDa)

6.56

Isoelectric Point (pI)

37.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 207
AcuI CTGAAG 1 cut(s) 111
AgsI TTSAA 1 cut(s) 209
AjnI CCWGG 1 cut(s) 188
AlwI GGATC 1 cut(s) 207
BciT130I CCWGG 1 cut(s) 190
BfaI CTAG 1 cut(s) 203
Bme1390I CCNGG 1 cut(s) 190
BmrFI CCNGG 1 cut(s) 190
BsaJI CCNNGG 1 cut(s) 189
Bse118I RCCGGY 1 cut(s) 104
Bse1I ACTGG 2 cut(s) 160, 164
BseBI CCWGG 1 cut(s) 190
BseDI CCNNGG 1 cut(s) 189
BseNI ACTGG 2 cut(s) 160, 164
BsiSI CCGG 1 cut(s) 105
Bsp143I GATC 1 cut(s) 199
BspPI GGATC 1 cut(s) 207
BsrFI RCCGGY 1 cut(s) 104
BsrI ACTGG 2 cut(s) 160, 164
BssAI RCCGGY 1 cut(s) 104
BssECI CCNNGG 1 cut(s) 189
BssMI GATC 1 cut(s) 199
Bst2UI CCWGG 1 cut(s) 190
BstC8I GCNNGC 1 cut(s) 232
BstDEI CTNAG 1 cut(s) 302
BstKTI GATC 1 cut(s) 202
BstMBI GATC 1 cut(s) 199
BstNI CCWGG 1 cut(s) 190
BstSCI CCNGG 1 cut(s) 188
BstX2I RGATCY 1 cut(s) 199
BstYI RGATCY 1 cut(s) 199
Cac8I GCNNGC 1 cut(s) 232
Cfr10I RCCGGY 1 cut(s) 104
DdeI CTNAG 1 cut(s) 302
DpnI GATC 1 cut(s) 201
DpnII GATC 1 cut(s) 199
Eco57I CTGAAG 1 cut(s) 111
EcoRII CCWGG 1 cut(s) 188
FaiI YATR 5 cut(s) 10, 46, 140, 223, 293
FspBI CTAG 1 cut(s) 203
HapII CCGG 1 cut(s) 105
HincII GTYRAC 1 cut(s) 153
HindII GTYRAC 1 cut(s) 153
HinfI GANTC 1 cut(s) 272
HpaII CCGG 1 cut(s) 105
Hpy166II GTNNAC 1 cut(s) 153
Hpy188I TCNGA 1 cut(s) 57
Hpy188III TCNNGA 1 cut(s) 269
Hpy8I GTNNAC 1 cut(s) 153
HpyAV CCTTC 4 cut(s) 62, 86, 252, 303
HpyF3I CTNAG 1 cut(s) 302
Kzo9I GATC 1 cut(s) 199
LmnI GCTCC 1 cut(s) 53
LpnPI CCDG 9 cut(s) 39, 118, 141, 175, 177, 182, 202, 244, 254
MaeI CTAG 1 cut(s) 203
MaeIII GTNAC 1 cut(s) 32
MalI GATC 1 cut(s) 201
MboI GATC 1 cut(s) 199
MflI RGATCY 1 cut(s) 199
MluCI AATT 2 cut(s) 60, 146
MnlI CCTC 2 cut(s) 251, 299
MseI TTAA 1 cut(s) 101
MspI CCGG 1 cut(s) 105
MspR9I CCNGG 1 cut(s) 190
MvaI CCWGG 1 cut(s) 190
NdeII GATC 1 cut(s) 199
PfeI GAWTC 1 cut(s) 272
Psp6I CCWGG 1 cut(s) 188
PspGI CCWGG 1 cut(s) 188
PsuI RGATCY 1 cut(s) 199
SaqAI TTAA 1 cut(s) 101
Sau3AI GATC 1 cut(s) 199
ScrFI CCNGG 1 cut(s) 190
SetI ASST 4 cut(s) 97, 228, 243, 314
Sse9I AATT 2 cut(s) 60, 146
SspMI CTAG 1 cut(s) 203
StyD4I CCNGG 1 cut(s) 188
TaqI TCGA 2 cut(s) 144, 181
TasI AATT 2 cut(s) 60, 146
TfiI GAWTC 1 cut(s) 272
Tru1I TTAA 1 cut(s) 101
Tru9I TTAA 1 cut(s) 101
TspDTI ATGAA 2 cut(s) 57, 63
XspI CTAG 1 cut(s) 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.