Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8129536.1

Orthogroup ID

OG0016242

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 560

Gene Structure 559 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8129536.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 559 bp

atgagtcatgagattgcacaagaatacttgagccgcttcaaattagctagagcactatgccgagtaagactgcctgaatcagagtttgtggatatggctgtaactggtttgagcttcaaattcatagaacattttgagggtgttaccttcaatgatctattcgagttcgagacaagaatcgatcagtatgatgccatcttgagggaggaagctcaaaagcgggcagcatcaaagggtacaaattacaagaatcaggccgttaatgcggtcgacaggtttggagtggatttaaacgaagactcggttaaagtggattcggctaaaatggtgattaagcaaccccgtgtgtgcaaagctttggaatgggttgacccaaagcaaaccaaaccaccaccaacccaaagcacaagcacaacaaaaactaatgcacgcacttacactttcaatatagctaagaccgatttcatctttgatcaactcttggccgagaagatgattcaactttcttttggccatatactccccaaggccgaagaaatcaaggggaagactttttgca

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_1 RVT_3 rve

Protein Analysis

186

Amino Acids

21.3

Weight (kDa)

7.69

Isoelectric Point (pI)

38.22

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016242)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g21401 FvH4_1g29791 FvH4_1g29792
rosa_chinensis	RchiOBHm_Chr1g0329401
rosa_multiflora	Rmu_co8129536.1_g000001 Rmu_sc0009012.1_g000015 Rmu_sc0009469.1_g000005 Rmu_sc0028470.1_g000001
rosa_roxburghii	Rroxscaffold_1G00059280
rosa_samantha	Rh3CG291200 Rh5AG339600 Rh5DG462600 Rh6DG198800 Rh7DG348000 Rh7DG406000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	270
AciI	CCGC	3 cut(s)	34, 220, 266
AcoI	YGGCCR	2 cut(s)	483, 511
AcsI	RAATTY	1 cut(s)	119
AfaI	GTAC	1 cut(s)	238
AfiI	CCNNNNNNNGG	1 cut(s)	201
AgsI	TTSAA	5 cut(s)	40, 118, 151, 445, 500
AluBI	AGCT	5 cut(s)	47, 114, 212, 356, 452
AluI	AGCT	5 cut(s)	47, 114, 212, 356, 452
Alw21I	GWGCWC	1 cut(s)	55
Alw26I	GTCTC	1 cut(s)	164
AoxI	GGCC	4 cut(s)	255, 483, 511, 528
ApeKI	GCWGC	1 cut(s)	224
ApoI	RAATTY	1 cut(s)	119
AsuHPI	GGTGA	1 cut(s)	340
BalI	TGGCCA	1 cut(s)	513
BbsI	GAAGAC	2 cut(s)	303, 554
Bbv12I	GWGCWC	1 cut(s)	55
BbvI	GCAGC	1 cut(s)	236
BccI	CCATC	1 cut(s)	203
BceAI	ACGGC	1 cut(s)	242
BclI	TGATCA	1 cut(s)	472
BcoDI	GTCTC	1 cut(s)	164
BfaI	CTAG	1 cut(s)	48
BisI	GCNGC	2 cut(s)	34, 225
BlsI	GCNGC	2 cut(s)	35, 226
BmsI	GCATC	2 cut(s)	181, 236
BpiI	GAAGAC	2 cut(s)	303, 554
BpuEI	CTTGAG	2 cut(s)	49, 220
Bsa29I	ATCGAT	1 cut(s)	180
BsaJI	CCNNGG	1 cut(s)	525
Bsc4I	CCNNNNNNNGG	1 cut(s)	201
Bse1I	ACTGG	1 cut(s)	109
BseCI	ATCGAT	1 cut(s)	180
BseDI	CCNNGG	1 cut(s)	525
BseLI	CCNNNNNNNGG	1 cut(s)	201
BseNI	ACTGG	1 cut(s)	109
BseXI	GCAGC	1 cut(s)	236
Bsh1285I	CGRYCG	1 cut(s)	270
BshFI	GGCC	4 cut(s)	257, 485, 513, 530
BshVI	ATCGAT	1 cut(s)	180
BsiEI	CGRYCG	1 cut(s)	270
BsiHKAI	GWGCWC	1 cut(s)	55
BslI	CCNNNNNNNGG	1 cut(s)	201
BsmAI	GTCTC	1 cut(s)	164
BsnI	GGCC	4 cut(s)	257, 485, 513, 530
Bsp1286I	GDGCHC	1 cut(s)	55
Bsp143I	GATC	3 cut(s)	154, 181, 472
BspACI	CCGC	3 cut(s)	34, 220, 266
BspANI	GGCC	4 cut(s)	257, 485, 513, 530
BspDI	ATCGAT	1 cut(s)	180
BspHI	TCATGA	1 cut(s)	7
BsrI	ACTGG	1 cut(s)	109
BssECI	CCNNGG	1 cut(s)	525
BssMI	GATC	3 cut(s)	154, 181, 472
BssT1I	CCWWGG	1 cut(s)	525
BstC8I	GCNNGC	2 cut(s)	222, 430
BstDEI	CTNAG	1 cut(s)	453
BstKTI	GATC	3 cut(s)	157, 184, 475
BstMAI	GTCTC	1 cut(s)	164
BstMBI	GATC	3 cut(s)	154, 181, 472
BstMCI	CGRYCG	1 cut(s)	270
BstMWI	GCNNNNNNNGC	1 cut(s)	263
BstV1I	GCAGC	1 cut(s)	236
BstV2I	GAAGAC	2 cut(s)	303, 554
Bsu15I	ATCGAT	1 cut(s)	180
BsuRI	GGCC	4 cut(s)	257, 485, 513, 530
BsuTUI	ATCGAT	1 cut(s)	180
Cac8I	GCNNGC	2 cut(s)	222, 430
CciI	TCATGA	1 cut(s)	7
ClaI	ATCGAT	1 cut(s)	180
Csp6I	GTAC	1 cut(s)	237
CviAII	CATG	1 cut(s)	8
CviQI	GTAC	1 cut(s)	237
DdeI	CTNAG	1 cut(s)	453
DpnI	GATC	3 cut(s)	156, 183, 474
DpnII	GATC	3 cut(s)	154, 181, 472
DraI	TTTAAA	1 cut(s)	291
EaeI	YGGCCR	2 cut(s)	483, 511
Eco130I	CCWWGG	1 cut(s)	525
EcoT14I	CCWWGG	1 cut(s)	525
ErhI	CCWWGG	1 cut(s)	525
FaeI	CATG	1 cut(s)	11
FaiI	YATR	8 cut(s)	9, 58, 95, 125, 189, 449, 516, 518
FatI	CATG	1 cut(s)	7
FauI	CCCGC	1 cut(s)	213
FbaI	TGATCA	1 cut(s)	472
FblI	GTMKAC	1 cut(s)	270
Fnu4HI	GCNGC	2 cut(s)	34, 225
Fsp4HI	GCNGC	2 cut(s)	34, 225
FspBI	CTAG	1 cut(s)	48
GluI	GCNGC	2 cut(s)	34, 225
HaeIII	GGCC	4 cut(s)	257, 485, 513, 530
Hin1II	CATG	1 cut(s)	11
HincII	GTYRAC	2 cut(s)	271, 370
HindII	GTYRAC	2 cut(s)	271, 370
HindIII	AAGCTT	1 cut(s)	354
HinfI	GANTC	7 cut(s)	4, 77, 177, 250, 299, 314, 496
HphI	GGTGA	1 cut(s)	340
Hpy166II	GTNNAC	2 cut(s)	271, 370
Hpy188I	TCNGA	1 cut(s)	82
Hpy188III	TCNNGA	3 cut(s)	8, 169, 199
Hpy8I	GTNNAC	2 cut(s)	271, 370
HpyAV	CCTTC	1 cut(s)	157
HpyCH4V	TGCA	4 cut(s)	17, 351, 428, 558
HpyF10VI	GCNNNNNNNGC	1 cut(s)	263
HpyF3I	CTNAG	1 cut(s)	453
Hsp92II	CATG	1 cut(s)	11
Ksp22I	TGATCA	1 cut(s)	472
Kzo9I	GATC	3 cut(s)	154, 181, 472
LpnPI	CCDG	4 cut(s)	87, 90, 239, 259
Lsp1109I	GCAGC	1 cut(s)	236
LweI	GCATC	2 cut(s)	181, 236
MaeI	CTAG	1 cut(s)	48
MaeIII	GTNAC	2 cut(s)	100, 142
MalI	GATC	3 cut(s)	156, 183, 474
MboI	GATC	3 cut(s)	154, 181, 472
MboII	GAAGA	4 cut(s)	308, 502, 545, 559
MhlI	GDGCHC	1 cut(s)	55
MlsI	TGGCCA	1 cut(s)	513
MluCI	AATT	3 cut(s)	41, 119, 241
MluNI	TGGCCA	1 cut(s)	513
MlyI	GAGTC	2 cut(s)	13, 293
MnlI	CCTC	3 cut(s)	130, 195, 199
Mox20I	TGGCCA	1 cut(s)	513
MscI	TGGCCA	1 cut(s)	513
MseI	TTAA	4 cut(s)	261, 290, 306, 333
Msp20I	TGGCCA	1 cut(s)	513
MwoI	GCNNNNNNNGC	1 cut(s)	263
NdeII	GATC	3 cut(s)	154, 181, 472
NlaIII	CATG	1 cut(s)	11
NmeAIII	GCCGAG	2 cut(s)	86, 511
PagI	TCATGA	1 cut(s)	7
PfeI	GAWTC	5 cut(s)	77, 177, 250, 314, 496
PkrI	GCNGC	2 cut(s)	35, 226
PleI	GAGTC	2 cut(s)	12, 293
PpsI	GAGTC	2 cut(s)	12, 293
RsaI	GTAC	1 cut(s)	238
RsaNI	GTAC	1 cut(s)	237
SalI	GTCGAC	1 cut(s)	269
SaqAI	TTAA	4 cut(s)	261, 290, 306, 333
SatI	GCNGC	2 cut(s)	34, 225
Sau3AI	GATC	3 cut(s)	154, 181, 472
SchI	GAGTC	2 cut(s)	13, 293
SduI	GDGCHC	1 cut(s)	55
SetI	ASST	7 cut(s)	49, 116, 149, 214, 278, 358, 454
SfaNI	GCATC	2 cut(s)	181, 236
SmlI	CTYRAG	2 cut(s)	28, 199
SmoI	CTYRAG	2 cut(s)	28, 199
Sse9I	AATT	3 cut(s)	41, 119, 241
SsiI	CCGC	3 cut(s)	34, 220, 266
SspMI	CTAG	1 cut(s)	48
StyI	CCWWGG	1 cut(s)	525
TaqI	TCGA	4 cut(s)	162, 168, 180, 270
TaqII	GACCGA	1 cut(s)	473
TasI	AATT	3 cut(s)	41, 119, 241
TauI	GCSGC	1 cut(s)	36
TfiI	GAWTC	5 cut(s)	77, 177, 250, 314, 496
Tru1I	TTAA	4 cut(s)	261, 290, 306, 333
Tru9I	TTAA	4 cut(s)	261, 290, 306, 333
TseI	GCWGC	1 cut(s)	224
TspDTI	ATGAA	2 cut(s)	112, 454
XapI	RAATTY	1 cut(s)	119
XmiI	GTMKAC	1 cut(s)	270
XspI	CTAG	1 cut(s)	48

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.