RchiOBHm_Chr1g0335061

exocyst complex component

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0002387
Physical Location & Seq
Reverse (-)
27261389 .. 27263801
2413 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ56374

Sequence Viewer

Length: 381 bp
ATGAGGTTAACAGCTCTTGATGGAAAGCGGAGGTTTGCATTAGCAGCTGCAGGATCCCACAAGGAAGAGACATTTGAGAAGACGCTATGGTGCCACATTTCCAACTTCTATAATCTTTCCAAAGAAAGCCCACAAACTCTGGTGCGTGCTTTAAGAGTTGTTCAAATGCAAGAAATCCTTGACCAACAACTTGCTGAAGAAGCAGCTGAGGCTGAAGGAGGTGGTGCCATGGCATCAATTGCCAATCCTCGTAGAACTGCCAAAAAAACTACCACAGCAATAGCTTCTTCGAGAAATATGACACAGCAGAAACTGAATATACAAGGCAAAGGCTACAAGGACAAATGCTATGATCAAATTAGGAAGACTGTTGAAGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Sec6

Protein Analysis

126

Amino Acids

14.05

Weight (kDa)

9.51

Isoelectric Point (pI)

59.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Sec6 PF06046 23 - 125 6.4e-13 Exocyst complex component Sec6
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 90, 224
AciI CCGC 1 cut(s) 28
AclWI GGATC 2 cut(s) 48, 61
AcuI CTGAAG 2 cut(s) 216, 234
AgsI TTSAA 2 cut(s) 164, 374
AluBI AGCT 4 cut(s) 14, 47, 206, 284
AluI AGCT 4 cut(s) 14, 47, 206, 284
Alw26I GTCTC 1 cut(s) 62
AlwI GGATC 2 cut(s) 48, 61
AlwNI CAGNNNCTG 1 cut(s) 313
ApeKI GCWGC 3 cut(s) 44, 47, 203
BamHI GGATCC 1 cut(s) 53
BanI GGYRCC 2 cut(s) 90, 224
BbsI GAAGAC 2 cut(s) 86, 371
BbvCI CCTCAGC 1 cut(s) 207
BbvI GCAGC 3 cut(s) 34, 56, 215
BccI CCATC 1 cut(s) 14
BclI TGATCA 1 cut(s) 352
BcoDI GTCTC 1 cut(s) 62
BfmI CTRYAG 1 cut(s) 48
BisI GCNGC 3 cut(s) 45, 48, 204
BlsI GCNGC 3 cut(s) 46, 49, 205
BmiI GGNNCC 3 cut(s) 55, 92, 226
BmsI GCATC 1 cut(s) 242
BpiI GAAGAC 2 cut(s) 86, 371
Bpu10I CCTNAGC 1 cut(s) 207
BsaJI CCNNGG 1 cut(s) 228
BseDI CCNNGG 1 cut(s) 228
BseMII CTCAG 1 cut(s) 198
BseXI GCAGC 3 cut(s) 34, 56, 215
BshNI GGYRCC 2 cut(s) 90, 224
BsmAI GTCTC 1 cut(s) 62
Bsp143I GATC 2 cut(s) 53, 352
Bsp19I CCATGG 1 cut(s) 228
BspACI CCGC 1 cut(s) 28
BspCNI CTCAG 1 cut(s) 199
BspLI GGNNCC 3 cut(s) 55, 92, 226
BspMAI CTGCAG 1 cut(s) 52
BspPI GGATC 2 cut(s) 48, 61
BspT107I GGYRCC 2 cut(s) 90, 224
BssECI CCNNGG 1 cut(s) 228
BssMI GATC 2 cut(s) 53, 352
BssT1I CCWWGG 1 cut(s) 228
Bst4CI ACNGT 1 cut(s) 370
Bst6I CTCTTC 1 cut(s) 60
BstAPI GCANNNNNTGC 1 cut(s) 239
BstC8I GCNNGC 1 cut(s) 147
BstDEI CTNAG 1 cut(s) 207
BstDSI CCRYGG 1 cut(s) 228
BstKTI GATC 2 cut(s) 56, 355
BstMAI GTCTC 1 cut(s) 62
BstMBI GATC 2 cut(s) 53, 352
BstMWI GCNNNNNNNGC 4 cut(s) 44, 200, 209, 239
BstSFI CTRYAG 1 cut(s) 48
BstV1I GCAGC 3 cut(s) 34, 56, 215
BstV2I GAAGAC 2 cut(s) 86, 371
BstX2I RGATCY 1 cut(s) 53
BstYI RGATCY 1 cut(s) 53
BtgI CCRYGG 1 cut(s) 228
Cac8I GCNNGC 1 cut(s) 147
CaiI CAGNNNCTG 1 cut(s) 313
CseI GACGC 1 cut(s) 91
CviAII CATG 1 cut(s) 229
CviJI RGCY 7 cut(s) 14, 47, 129, 206, 212, 284, 333
CviKI_1 RGCY 7 cut(s) 14, 47, 129, 206, 212, 284, 333
DdeI CTNAG 1 cut(s) 207
DpnI GATC 2 cut(s) 55, 354
DpnII GATC 2 cut(s) 53, 352
Eam1104I CTCTTC 1 cut(s) 60
EarI CTCTTC 1 cut(s) 60
Eco130I CCWWGG 1 cut(s) 228
Eco57I CTGAAG 2 cut(s) 216, 234
EcoT14I CCWWGG 1 cut(s) 228
ErhI CCWWGG 1 cut(s) 228
FaeI CATG 1 cut(s) 232
FaiI YATR 6 cut(s) 88, 111, 230, 299, 320, 351
FalI AAGNNNNNCTT 2 cut(s) 162, 194
FatI CATG 1 cut(s) 228
FbaI TGATCA 1 cut(s) 352
Fnu4HI GCNGC 3 cut(s) 45, 48, 204
Fsp4HI GCNGC 3 cut(s) 45, 48, 204
GluI GCNGC 3 cut(s) 45, 48, 204
HgaI GACGC 1 cut(s) 91
Hin1II CATG 1 cut(s) 232
HincII GTYRAC 1 cut(s) 9
HindII GTYRAC 1 cut(s) 9
HpaI GTTAAC 1 cut(s) 9
Hpy166II GTNNAC 1 cut(s) 9
Hpy188III TCNNGA 2 cut(s) 17, 291
Hpy8I GTNNAC 1 cut(s) 9
HpyAV CCTTC 2 cut(s) 209, 368
HpyCH4III ACNGT 1 cut(s) 370
HpyCH4V TGCA 3 cut(s) 38, 50, 169
HpyF10VI GCNNNNNNNGC 4 cut(s) 44, 200, 209, 239
HpyF3I CTNAG 1 cut(s) 207
Hsp92II CATG 1 cut(s) 232
Ksp22I TGATCA 1 cut(s) 352
KspAI GTTAAC 1 cut(s) 9
Kzo9I GATC 2 cut(s) 53, 352
LpnPI CCDG 2 cut(s) 36, 125
Lsp1109I GCAGC 3 cut(s) 34, 56, 215
LweI GCATC 1 cut(s) 242
MalI GATC 2 cut(s) 55, 354
MboI GATC 2 cut(s) 53, 352
MboII GAAGA 5 cut(s) 77, 91, 209, 279, 376
MfeI CAATTG 1 cut(s) 237
MflI RGATCY 1 cut(s) 53
MluCI AATT 2 cut(s) 237, 357
MmeI TCCRAC 1 cut(s) 126
MnlI CCTC 4 cut(s) 24, 202, 212, 258
MseI TTAA 2 cut(s) 8, 152
MspA1I CMGCKG 2 cut(s) 47, 206
MunI CAATTG 1 cut(s) 237
MwoI GCNNNNNNNGC 4 cut(s) 44, 200, 209, 239
NcoI CCATGG 1 cut(s) 228
NdeII GATC 2 cut(s) 53, 352
NlaIII CATG 1 cut(s) 232
NlaIV GGNNCC 3 cut(s) 55, 92, 226
PkrI GCNGC 3 cut(s) 46, 49, 205
PspN4I GGNNCC 3 cut(s) 55, 92, 226
PstI CTGCAG 1 cut(s) 52
PstNI CAGNNNCTG 1 cut(s) 313
PsuI RGATCY 1 cut(s) 53
PvuII CAGCTG 2 cut(s) 47, 206
SaqAI TTAA 2 cut(s) 8, 152
SatI GCNGC 3 cut(s) 45, 48, 204
Sau3AI GATC 2 cut(s) 53, 352
SetI ASST 7 cut(s) 8, 16, 35, 49, 208, 223, 286
SfaNI GCATC 1 cut(s) 242
SfcI CTRYAG 1 cut(s) 48
Sse9I AATT 2 cut(s) 237, 357
SsiI CCGC 1 cut(s) 28
StyI CCWWGG 1 cut(s) 228
TaaI ACNGT 1 cut(s) 370
TaqI TCGA 1 cut(s) 290
TasI AATT 2 cut(s) 237, 357
Tru1I TTAA 2 cut(s) 8, 152
Tru9I TTAA 2 cut(s) 8, 152
TseI GCWGC 3 cut(s) 44, 47, 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.