Rroxscaffold_4G00316140

exocyst complex component

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
40769978 .. 40772781
2804 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00316140.1

Sequence Viewer

Length: 681 bp
ATGAGATTAACAGCTCTTGATGGAAAGCGGAGGTTTGCATTAGCCGCTGCAGGATCCCAGAAGGAAGAGGTTGGCAGGCTAAGGGAATATTTTGAAGATGTTGATAGGACCTGGGAGACATTCGAGAAGATATGGTGCTACATTTTGAACTTCTATAATCTTTCCAAAGAAAGCCCGCAAACTCTGGTGCGTGATTTAAGAGTTGTTGAAATGCAAGAAATCCTTGATCAACAACTTGCTGAAGAAGCAGCTGAGGCTGAAGGAGGTGGTGCTATGGCAACAATTGCCAATCCTCATAGAACTGCCAAAAAAACTACCACAGCAATAGCTTCTTTGAGAAATATGACACAGCAGAAACTGAATATACAAGGCAAAGGCTATAAGAACAAATGCTATGATCAAATTAGGAAGACTGTTGAAGGACGATTCAACAGGCTACTGACAGAGCTTTGTTTCGAGGATCTTAAAGCAGCACCAGAGGAAGCTCGAACAATTGGAGAAGAGCTTGGAGATATATACGATCATGCGGCCCCTTGCTCCCCCCATGTTTGCTCTTTCTATTTTCACTGGTTTATAATGTTTGAGCCAATACATCAATTTGTCGTCTTATTTAGGTGTAAACTTCCCACTATTTCCTTATCTCAGATGCTGAAAGGCTCTGAATGCCCCAAGATAGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

226

Amino Acids

25.98

Weight (kDa)

6.26

Isoelectric Point (pI)

48.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Sec6 PF06046 31 - 191 5.4e-19 Exocyst complex component Sec6
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 575
AciI CCGC 4 cut(s) 28, 45, 176, 527
AclWI GGATC 3 cut(s) 48, 61, 468
AcuI CTGAAG 2 cut(s) 261, 279
AgsI TTSAA 5 cut(s) 95, 148, 209, 419, 430
AjnI CCWGG 1 cut(s) 110
AluBI AGCT 6 cut(s) 14, 251, 329, 448, 485, 505
AluI AGCT 6 cut(s) 14, 251, 329, 448, 485, 505
Alw26I GTCTC 1 cut(s) 110
AlwI GGATC 3 cut(s) 48, 61, 468
AlwNI CAGNNNCTG 2 cut(s) 358, 649
AoxI GGCC 1 cut(s) 528
ApeKI GCWGC 3 cut(s) 47, 248, 470
AspS9I GGNCC 2 cut(s) 108, 529
AvaII GGWCC 1 cut(s) 108
BamHI GGATCC 1 cut(s) 53
BbsI GAAGAC 1 cut(s) 416
BbvCI CCTCAGC 1 cut(s) 252
BbvI GCAGC 3 cut(s) 34, 260, 482
BccI CCATC 1 cut(s) 14
BciT130I CCWGG 1 cut(s) 112
BclI TGATCA 2 cut(s) 226, 397
BcoDI GTCTC 1 cut(s) 110
BfmI CTRYAG 1 cut(s) 48
BisI GCNGC 5 cut(s) 45, 48, 249, 471, 528
BlsI GCNGC 5 cut(s) 46, 49, 250, 472, 529
Bme1390I CCNGG 1 cut(s) 112
Bme18I GGWCC 1 cut(s) 108
BmgT120I GGNCC 2 cut(s) 108, 529
BmiI GGNNCC 2 cut(s) 55, 531
BmrFI CCNGG 1 cut(s) 112
BmsI GCATC 1 cut(s) 636
BpiI GAAGAC 1 cut(s) 416
Bpu10I CCTNAGC 2 cut(s) 80, 252
BsaJI CCNNGG 1 cut(s) 111
Bse1I ACTGG 1 cut(s) 572
BseBI CCWGG 1 cut(s) 112
BseDI CCNNGG 1 cut(s) 111
BseMII CTCAG 2 cut(s) 243, 656
BseNI ACTGG 1 cut(s) 572
BseXI GCAGC 3 cut(s) 34, 260, 482
BshFI GGCC 1 cut(s) 530
BsmAI GTCTC 1 cut(s) 110
BsmI GAATGC 1 cut(s) 668
BsnI GGCC 1 cut(s) 530
Bsp143I GATC 5 cut(s) 53, 226, 397, 460, 520
BspACI CCGC 4 cut(s) 28, 45, 176, 527
BspANI GGCC 1 cut(s) 530
BspCNI CTCAG 2 cut(s) 244, 655
BspLI GGNNCC 2 cut(s) 55, 531
BspMAI CTGCAG 1 cut(s) 52
BspPI GGATC 3 cut(s) 48, 61, 468
BspQI GCTCTTC 1 cut(s) 495
BsrI ACTGG 1 cut(s) 572
BssECI CCNNGG 1 cut(s) 111
BssMI GATC 5 cut(s) 53, 226, 397, 460, 520
Bst2UI CCWGG 1 cut(s) 112
Bst4CI ACNGT 1 cut(s) 415
Bst6I CTCTTC 2 cut(s) 60, 495
BstAPI GCANNNNNTGC 1 cut(s) 284
BstC8I GCNNGC 2 cut(s) 77, 176
BstDEI CTNAG 3 cut(s) 80, 252, 642
BstKTI GATC 5 cut(s) 56, 229, 400, 463, 523
BstMAI GTCTC 1 cut(s) 110
BstMBI GATC 5 cut(s) 53, 226, 397, 460, 520
BstMWI GCNNNNNNNGC 5 cut(s) 44, 245, 254, 284, 663
BstNI CCWGG 1 cut(s) 112
BstSCI CCNGG 1 cut(s) 110
BstSFI CTRYAG 1 cut(s) 48
BstV1I GCAGC 3 cut(s) 34, 260, 482
BstV2I GAAGAC 1 cut(s) 416
BstX2I RGATCY 2 cut(s) 53, 460
BstYI RGATCY 2 cut(s) 53, 460
BsuRI GGCC 1 cut(s) 530
BtsIMutI CAGTG 1 cut(s) 565
Cac8I GCNNGC 2 cut(s) 77, 176
CaiI CAGNNNCTG 2 cut(s) 358, 649
Cfr13I GGNCC 2 cut(s) 108, 529
CviAII CATG 2 cut(s) 524, 545
DdeI CTNAG 3 cut(s) 80, 252, 642
DpnI GATC 5 cut(s) 55, 228, 399, 462, 522
DpnII GATC 5 cut(s) 53, 226, 397, 460, 520
Eam1104I CTCTTC 2 cut(s) 60, 495
EarI CTCTTC 2 cut(s) 60, 495
Eco47I GGWCC 1 cut(s) 108
Eco57I CTGAAG 2 cut(s) 261, 279
EcoO109I RGGNCCY 1 cut(s) 108
EcoRII CCWGG 1 cut(s) 110
FaeI CATG 2 cut(s) 527, 548
FalI AAGNNNNNCTT 2 cut(s) 207, 239
FatI CATG 2 cut(s) 523, 544
FauI CCCGC 1 cut(s) 183
FbaI TGATCA 2 cut(s) 226, 397
Fnu4HI GCNGC 5 cut(s) 45, 48, 249, 471, 528
Fsp4HI GCNGC 5 cut(s) 45, 48, 249, 471, 528
GluI GCNGC 5 cut(s) 45, 48, 249, 471, 528
HaeIII GGCC 1 cut(s) 530
Hin1II CATG 2 cut(s) 527, 548
HinfI GANTC 1 cut(s) 426
Hpy166II GTNNAC 1 cut(s) 620
Hpy188I TCNGA 2 cut(s) 645, 661
Hpy188III TCNNGA 2 cut(s) 17, 124
Hpy8I GTNNAC 1 cut(s) 620
HpyAV CCTTC 3 cut(s) 55, 254, 413
HpyCH4III ACNGT 1 cut(s) 415
HpyCH4V TGCA 3 cut(s) 38, 50, 214
HpyF10VI GCNNNNNNNGC 5 cut(s) 44, 245, 254, 284, 663
HpyF3I CTNAG 3 cut(s) 80, 252, 642
Hsp92II CATG 2 cut(s) 527, 548
Ksp22I TGATCA 2 cut(s) 226, 397
Kzo9I GATC 5 cut(s) 53, 226, 397, 460, 520
LguI GCTCTTC 1 cut(s) 495
LmnI GCTCC 1 cut(s) 542
LpnPI CCDG 9 cut(s) 36, 61, 71, 97, 124, 170, 418, 489, 553
Lsp1109I GCAGC 3 cut(s) 34, 260, 482
LweI GCATC 1 cut(s) 636
MalI GATC 5 cut(s) 55, 228, 399, 462, 522
MboI GATC 5 cut(s) 53, 226, 397, 460, 520
MboII GAAGA 6 cut(s) 77, 107, 139, 254, 421, 512
MfeI CAATTG 2 cut(s) 282, 492
MflI RGATCY 2 cut(s) 53, 460
MluCI AATT 4 cut(s) 282, 402, 492, 596
MnlI CCTC 7 cut(s) 24, 61, 247, 257, 303, 451, 472
MseI TTAA 3 cut(s) 8, 197, 465
MspA1I CMGCKG 2 cut(s) 47, 251
MspR9I CCNGG 1 cut(s) 112
MunI CAATTG 2 cut(s) 282, 492
Mva1269I GAATGC 1 cut(s) 668
MvaI CCWGG 1 cut(s) 112
MwoI GCNNNNNNNGC 5 cut(s) 44, 245, 254, 284, 663
NdeII GATC 5 cut(s) 53, 226, 397, 460, 520
NlaIII CATG 2 cut(s) 527, 548
NlaIV GGNNCC 2 cut(s) 55, 531
PciSI GCTCTTC 1 cut(s) 495
PctI GAATGC 1 cut(s) 668
PfeI GAWTC 1 cut(s) 426
PkrI GCNGC 5 cut(s) 46, 49, 250, 472, 529
PpuMI RGGWCCY 1 cut(s) 108
PsiI TTATAA 1 cut(s) 575
Psp5II RGGWCCY 1 cut(s) 108
Psp6I CCWGG 1 cut(s) 110
PspGI CCWGG 1 cut(s) 110
PspN4I GGNNCC 2 cut(s) 55, 531
PspPI GGNCC 2 cut(s) 108, 529
PspPPI RGGWCCY 1 cut(s) 108
PstI CTGCAG 1 cut(s) 52
PstNI CAGNNNCTG 2 cut(s) 358, 649
PsuI RGATCY 2 cut(s) 53, 460
PvuII CAGCTG 1 cut(s) 251
SapI GCTCTTC 1 cut(s) 495
SaqAI TTAA 3 cut(s) 8, 197, 465
SatI GCNGC 5 cut(s) 45, 48, 249, 471, 528
Sau3AI GATC 5 cut(s) 53, 226, 397, 460, 520
Sau96I GGNCC 2 cut(s) 108, 529
ScrFI CCNGG 1 cut(s) 112
SfaNI GCATC 1 cut(s) 636
SfcI CTRYAG 1 cut(s) 48
SinI GGWCC 1 cut(s) 108
Sse9I AATT 4 cut(s) 282, 402, 492, 596
SsiI CCGC 4 cut(s) 28, 45, 176, 527
SspI AATATT 1 cut(s) 89
StyD4I CCNGG 1 cut(s) 110
TaaI ACNGT 1 cut(s) 415
TaqI TCGA 3 cut(s) 123, 456, 487
TasI AATT 4 cut(s) 282, 402, 492, 596
TauI GCSGC 2 cut(s) 47, 530
TfiI GAWTC 1 cut(s) 426
Tru1I TTAA 3 cut(s) 8, 197, 465
Tru9I TTAA 3 cut(s) 8, 197, 465
TscAI CASTG 1 cut(s) 572
TseI GCWGC 3 cut(s) 47, 248, 470
TspRI CASTG 1 cut(s) 572
VpaK11BI GGWCC 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.