RchiOBHm_Chr1g0337681

Transcription elongation factor B polypeptide

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
29616609 .. 29617172
564 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ56557

Sequence Viewer

Length: 564 bp
ATGGATCAAGCTAACATCAATGATCAGAAGGGAAAGGCTCTATCTTTTGTCGACGTCAGTATGGCCATAGATAATCGGATGTTTCTCGGCGATGTGAGCGACATGGACTTGGATCTTCTCGAGCAGATCTTACCTCATAGTTTCAAGACGCATTTGATCCAGATAGAGAAGTCCACAAAAGACAGAGATCTGAGTCTAGTGACTAATAAGTTGTGGAAGAGTTTCTATGAGAAGATCGAATCAACCGATTCAGTTTCGGAGATAATGAAGGAGTGGAATCTCAAATTTAAGTGGTCGGAGTTGTACCAGGAGAAATCAAAAAGAGTGAAAGAGGCTGAGAAGAAAGAAGATGACAGGAAACTGAGCCAGCAAGTTAGGGTTTGCAAGAAGGTTCCACCATCTTCAAGCGATACAAGAAACAGGCCAAAGAGCAAGTTGATGAAGAAAATTGTTAAGGAGTATTTACATGAAATGTCTAGAGATGCGAAACATACGAGCTATGGAAAAGGAAGAAGGAAGTTGATGAGCTATGAATATTCGAGATGCCAAGGGTGCTTTCAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

187

Amino Acids

22.07

Weight (kDa)

9.34

Isoelectric Point (pI)

38.59

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Elongin_A PF06881 30 - 126 1e-10 RNA polymerase II transcription factor SIII (Elongin) subunit A
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 57
AccI GTMKAC 1 cut(s) 51
AclWI GGATC 3 cut(s) 12, 120, 151
AcoI YGGCCR 1 cut(s) 63
AcsI RAATTY 1 cut(s) 284
AcyI GRCGYC 1 cut(s) 54
AfaI GTAC 1 cut(s) 305
AgsI TTSAA 2 cut(s) 145, 405
AjnI CCWGG 1 cut(s) 306
AjuI GAANNNNNNNTTGG 1 cut(s) 540
AluBI AGCT 3 cut(s) 11, 498, 528
AluI AGCT 3 cut(s) 11, 498, 528
AlwI GGATC 3 cut(s) 12, 120, 151
Ama87I CYCGRG 1 cut(s) 119
AoxI GGCC 2 cut(s) 63, 422
ApoI RAATTY 1 cut(s) 284
Asp700I GAANNNNTTC 1 cut(s) 221
AvaI CYCGRG 1 cut(s) 119
BalI TGGCCA 1 cut(s) 65
BccI CCATC 1 cut(s) 406
BciT130I CCWGG 1 cut(s) 308
BclI TGATCA 1 cut(s) 22
BfaI CTAG 2 cut(s) 197, 477
BglII AGATCT 2 cut(s) 126, 187
Bme1390I CCNGG 1 cut(s) 308
BmeT110I CYCGRG 1 cut(s) 119
BmiI GGNNCC 1 cut(s) 393
BmrFI CCNGG 1 cut(s) 308
BmsI GCATC 2 cut(s) 472, 533
BsaHI GRCGYC 1 cut(s) 54
BsaJI CCNNGG 1 cut(s) 547
BseBI CCWGG 1 cut(s) 308
BseDI CCNNGG 1 cut(s) 547
BseGI GGATG 1 cut(s) 84
BseMII CTCAG 3 cut(s) 182, 327, 353
BshFI GGCC 2 cut(s) 65, 424
BsiHKCI CYCGRG 1 cut(s) 119
BsnI GGCC 2 cut(s) 65, 424
BsoBI CYCGRG 1 cut(s) 119
Bsp143I GATC 7 cut(s) 4, 22, 112, 126, 156, 187, 234
BspANI GGCC 2 cut(s) 65, 424
BspCNI CTCAG 3 cut(s) 183, 328, 354
BspLI GGNNCC 1 cut(s) 393
BspPI GGATC 3 cut(s) 12, 120, 151
BssECI CCNNGG 1 cut(s) 547
BssMI GATC 7 cut(s) 4, 22, 112, 126, 156, 187, 234
BssNI GRCGYC 1 cut(s) 54
BssT1I CCWWGG 1 cut(s) 547
Bst2UI CCWGG 1 cut(s) 308
Bst6I CTCTTC 1 cut(s) 212
BstACI GRCGYC 1 cut(s) 54
BstC8I GCNNGC 1 cut(s) 368
BstDEI CTNAG 3 cut(s) 191, 336, 362
BstF5I GGATG 1 cut(s) 84
BstKTI GATC 7 cut(s) 7, 25, 115, 129, 159, 190, 237
BstMBI GATC 7 cut(s) 4, 22, 112, 126, 156, 187, 234
BstMWI GCNNNNNNNGC 2 cut(s) 96, 552
BstNI CCWGG 1 cut(s) 308
BstSCI CCNGG 1 cut(s) 306
BstX2I RGATCY 3 cut(s) 112, 126, 187
BstYI RGATCY 3 cut(s) 112, 126, 187
BsuRI GGCC 2 cut(s) 65, 424
BtgZI GCGATG 1 cut(s) 105
BtsCI GGATG 1 cut(s) 84
Cac8I GCNNGC 1 cut(s) 368
CseI GACGC 1 cut(s) 157
Csp6I GTAC 1 cut(s) 304
CviAII CATG 2 cut(s) 103, 467
CviJI RGCY 8 cut(s) 11, 38, 65, 335, 366, 424, 498, 528
CviKI_1 RGCY 8 cut(s) 11, 38, 65, 335, 366, 424, 498, 528
CviQI GTAC 1 cut(s) 304
DdeI CTNAG 3 cut(s) 191, 336, 362
DpnI GATC 7 cut(s) 6, 24, 114, 128, 158, 189, 236
DpnII GATC 7 cut(s) 4, 22, 112, 126, 156, 187, 234
EaeI YGGCCR 1 cut(s) 63
Eam1104I CTCTTC 1 cut(s) 212
EarI CTCTTC 1 cut(s) 212
Eco130I CCWWGG 1 cut(s) 547
Eco88I CYCGRG 1 cut(s) 119
EcoRII CCWGG 1 cut(s) 306
EcoT14I CCWWGG 1 cut(s) 547
ErhI CCWWGG 1 cut(s) 547
FaeI CATG 2 cut(s) 106, 470
FaiI YATR 9 cut(s) 62, 68, 104, 138, 228, 468, 492, 501, 531
FatI CATG 2 cut(s) 102, 466
FbaI TGATCA 1 cut(s) 22
FblI GTMKAC 1 cut(s) 51
FokI GGATG 1 cut(s) 91
FspBI CTAG 2 cut(s) 197, 477
HaeIII GGCC 2 cut(s) 65, 424
HgaI GACGC 1 cut(s) 157
Hin1I GRCGYC 1 cut(s) 54
Hin1II CATG 2 cut(s) 106, 470
HincII GTYRAC 1 cut(s) 52
HindII GTYRAC 1 cut(s) 52
HinfI GANTC 4 cut(s) 193, 239, 248, 277
Hpy166II GTNNAC 2 cut(s) 52, 174
Hpy188I TCNGA 5 cut(s) 27, 78, 192, 259, 298
Hpy188III TCNNGA 5 cut(s) 119, 145, 160, 477, 540
Hpy8I GTNNAC 2 cut(s) 52, 174
Hpy99I CGWCG 1 cut(s) 56
HpyAV CCTTC 4 cut(s) 22, 262, 382, 507
HpyCH4IV ACGT 1 cut(s) 54
HpyCH4V TGCA 1 cut(s) 384
HpyF10VI GCNNNNNNNGC 2 cut(s) 96, 552
HpyF3I CTNAG 3 cut(s) 191, 336, 362
HpySE526I ACGT 1 cut(s) 54
Hsp92I GRCGYC 1 cut(s) 54
Hsp92II CATG 2 cut(s) 106, 470
Ksp22I TGATCA 1 cut(s) 22
Kzo9I GATC 7 cut(s) 4, 22, 112, 126, 156, 187, 234
LpnPI CCDG 6 cut(s) 173, 293, 320, 340, 380, 406
LweI GCATC 2 cut(s) 472, 533
MaeI CTAG 2 cut(s) 197, 477
MaeII ACGT 1 cut(s) 54
MaeIII GTNAC 1 cut(s) 199
MalI GATC 7 cut(s) 6, 24, 114, 128, 158, 189, 236
MboI GATC 7 cut(s) 4, 22, 112, 126, 156, 187, 234
MboII GAAGA 8 cut(s) 107, 229, 244, 352, 359, 393, 454, 522
MflI RGATCY 3 cut(s) 112, 126, 187
MlsI TGGCCA 1 cut(s) 65
MluCI AATT 2 cut(s) 284, 447
MluNI TGGCCA 1 cut(s) 65
MlyI GAGTC 1 cut(s) 202
MmeI TCCRAC 1 cut(s) 276
MnlI CCTC 2 cut(s) 144, 325
Mox20I TGGCCA 1 cut(s) 65
MroXI GAANNNNTTC 1 cut(s) 221
MscI TGGCCA 1 cut(s) 65
MseI TTAA 2 cut(s) 288, 453
Msp20I TGGCCA 1 cut(s) 65
MspR9I CCNGG 1 cut(s) 308
MvaI CCWGG 1 cut(s) 308
MwoI GCNNNNNNNGC 2 cut(s) 96, 552
NdeII GATC 7 cut(s) 4, 22, 112, 126, 156, 187, 234
NlaIII CATG 2 cut(s) 106, 470
NlaIV GGNNCC 1 cut(s) 393
NmeAIII GCCGAG 1 cut(s) 66
NmuCI GTSAC 1 cut(s) 199
PaeR7I CTCGAG 1 cut(s) 119
PcsI WCGNNNNNNNCGW 1 cut(s) 243
PdmI GAANNNNTTC 1 cut(s) 221
PfeI GAWTC 3 cut(s) 239, 248, 277
PleI GAGTC 1 cut(s) 201
PpsI GAGTC 1 cut(s) 201
Psp6I CCWGG 1 cut(s) 306
PspGI CCWGG 1 cut(s) 306
PspN4I GGNNCC 1 cut(s) 393
PsuI RGATCY 3 cut(s) 112, 126, 187
RsaI GTAC 1 cut(s) 305
RsaNI GTAC 1 cut(s) 304
SalI GTCGAC 1 cut(s) 50
SaqAI TTAA 2 cut(s) 288, 453
Sau3AI GATC 7 cut(s) 4, 22, 112, 126, 156, 187, 234
SchI GAGTC 1 cut(s) 202
ScrFI CCNGG 1 cut(s) 308
SetI ASST 6 cut(s) 13, 57, 136, 393, 500, 530
SfaNI GCATC 2 cut(s) 472, 533
Sfr274I CTCGAG 1 cut(s) 119
SlaI CTCGAG 1 cut(s) 119
SmlI CTYRAG 1 cut(s) 119
SmoI CTYRAG 1 cut(s) 119
Sse9I AATT 2 cut(s) 284, 447
SspI AATATT 1 cut(s) 536
SspMI CTAG 2 cut(s) 197, 477
StyD4I CCNGG 1 cut(s) 306
StyI CCWWGG 1 cut(s) 547
TaiI ACGT 1 cut(s) 57
TaqI TCGA 4 cut(s) 51, 120, 237, 539
TasI AATT 2 cut(s) 284, 447
TfiI GAWTC 3 cut(s) 239, 248, 277
Tru1I TTAA 2 cut(s) 288, 453
Tru9I TTAA 2 cut(s) 288, 453
TseFI GTSAC 1 cut(s) 199
Tsp45I GTSAC 1 cut(s) 199
TspDTI ATGAA 4 cut(s) 281, 455, 483, 546
XapI RAATTY 1 cut(s) 284
XbaI TCTAGA 1 cut(s) 476
XhoI CTCGAG 1 cut(s) 119
XmiI GTMKAC 1 cut(s) 51
XmnI GAANNNNTTC 1 cut(s) 221
XspI CTAG 2 cut(s) 197, 477
ZraI GACGTC 1 cut(s) 55
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.