Rh1AG156500

Transcription elongation factor B polypeptide

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0013655
Physical Location & Seq
Reverse (-)
29273169 .. 29273492
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG156500.1

Sequence Viewer

Length: 324 bp
ATGGATCAAGCTAACACCGATGATCAGAAGGGAAAGGCTCTGTCTTTCGCCGACGTCAGTACGACCATAGACAATCGGAGGTTTCTAGGCGATGTGAGCGATATGGACTTGGATCTTCTCAAGCAGATCTTACCTCACTGTTCCAAGACGCAGTTGATCCATATAGAGAAGTCCACAAAAGACAGAGATCTAAGTCCAGTGACTGATACGCTGTGGAAGAGTTTCTATGAGAAGGAGTTCGGAATCGAATCCACCAATTCGGTTTCCGAGATAATGAAGGAGTGGAATCTCAAGTTCAAGTGGTCGGAGTTGTACCAGGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Elongin_A

Protein Analysis

107

Amino Acids

12.43

Weight (kDa)

4.93

Isoelectric Point (pI)

39.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Elongin_A PF06881 30 - 106 2.9e-15 RNA polymerase II transcription factor SIII (Elongin) subunit A
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 57
AclWI GGATC 3 cut(s) 12, 120, 151
AcyI GRCGYC 1 cut(s) 54
AfaI GTAC 2 cut(s) 61, 314
AgsI TTSAA 1 cut(s) 298
AjnI CCWGG 1 cut(s) 315
AluBI AGCT 1 cut(s) 11
AluI AGCT 1 cut(s) 11
AlwI GGATC 3 cut(s) 12, 120, 151
AlwNI CAGNNNCTG 1 cut(s) 203
Asp700I GAANNNNTTC 2 cut(s) 221, 236
BciT130I CCWGG 1 cut(s) 317
BclI TGATCA 1 cut(s) 22
BfaI CTAG 1 cut(s) 86
BglII AGATCT 2 cut(s) 126, 187
Bme1390I CCNGG 1 cut(s) 317
BmrFI CCNGG 1 cut(s) 317
BpuEI CTTGAG 2 cut(s) 104, 275
BsaHI GRCGYC 1 cut(s) 54
Bse1I ACTGG 1 cut(s) 197
BseBI CCWGG 1 cut(s) 317
BseNI ACTGG 1 cut(s) 197
Bsp143I GATC 6 cut(s) 4, 22, 112, 126, 156, 187
BspPI GGATC 3 cut(s) 12, 120, 151
BsrI ACTGG 1 cut(s) 197
BssMI GATC 6 cut(s) 4, 22, 112, 126, 156, 187
BssNI GRCGYC 1 cut(s) 54
Bst2UI CCWGG 1 cut(s) 317
Bst4CI ACNGT 1 cut(s) 140
Bst6I CTCTTC 1 cut(s) 212
BstACI GRCGYC 1 cut(s) 54
BstDEI CTNAG 1 cut(s) 191
BstKTI GATC 6 cut(s) 7, 25, 115, 129, 159, 190
BstMBI GATC 6 cut(s) 4, 22, 112, 126, 156, 187
BstMWI GCNNNNNNNGC 1 cut(s) 96
BstNI CCWGG 1 cut(s) 317
BstSCI CCNGG 1 cut(s) 315
BstX2I RGATCY 3 cut(s) 112, 126, 187
BstYI RGATCY 3 cut(s) 112, 126, 187
BtgZI GCGATG 1 cut(s) 105
BtsIMutI CAGTG 2 cut(s) 136, 204
CaiI CAGNNNCTG 1 cut(s) 203
CseI GACGC 1 cut(s) 157
CsiI ACCWGGT 1 cut(s) 315
Csp6I GTAC 2 cut(s) 60, 313
CviJI RGCY 2 cut(s) 11, 38
CviKI_1 RGCY 2 cut(s) 11, 38
CviQI GTAC 2 cut(s) 60, 313
DdeI CTNAG 1 cut(s) 191
DpnI GATC 6 cut(s) 6, 24, 114, 128, 158, 189
DpnII GATC 6 cut(s) 4, 22, 112, 126, 156, 187
Eam1104I CTCTTC 1 cut(s) 212
EarI CTCTTC 1 cut(s) 212
EcoRII CCWGG 1 cut(s) 315
FaiI YATR 5 cut(s) 68, 104, 162, 164, 228
FalI AAGNNNNNCTT 2 cut(s) 113, 145
FbaI TGATCA 1 cut(s) 22
FspBI CTAG 1 cut(s) 86
HgaI GACGC 1 cut(s) 157
Hin1I GRCGYC 1 cut(s) 54
HinfI GANTC 3 cut(s) 243, 248, 286
Hpy166II GTNNAC 1 cut(s) 174
Hpy188I TCNGA 5 cut(s) 27, 78, 242, 268, 307
Hpy8I GTNNAC 1 cut(s) 174
Hpy99I CGWCG 1 cut(s) 56
HpyAV CCTTC 3 cut(s) 22, 226, 271
HpyCH4III ACNGT 1 cut(s) 140
HpyCH4IV ACGT 1 cut(s) 54
HpyF10VI GCNNNNNNNGC 1 cut(s) 96
HpyF3I CTNAG 1 cut(s) 191
HpySE526I ACGT 1 cut(s) 54
Hsp92I GRCGYC 1 cut(s) 54
Ksp22I TGATCA 1 cut(s) 22
Kzo9I GATC 6 cut(s) 4, 22, 112, 126, 156, 187
LpnPI CCDG 2 cut(s) 210, 302
MabI ACCWGGT 1 cut(s) 315
MaeI CTAG 1 cut(s) 86
MaeII ACGT 1 cut(s) 54
MaeIII GTNAC 1 cut(s) 199
MalI GATC 6 cut(s) 6, 24, 114, 128, 158, 189
MboI GATC 6 cut(s) 4, 22, 112, 126, 156, 187
MboII GAAGA 2 cut(s) 107, 229
MflI RGATCY 3 cut(s) 112, 126, 187
MluCI AATT 1 cut(s) 256
MmeI TCCRAC 1 cut(s) 285
MnlI CCTC 2 cut(s) 72, 144
MroXI GAANNNNTTC 2 cut(s) 221, 236
MspR9I CCNGG 1 cut(s) 317
MvaI CCWGG 1 cut(s) 317
MwoI GCNNNNNNNGC 1 cut(s) 96
NdeII GATC 6 cut(s) 4, 22, 112, 126, 156, 187
NmuCI GTSAC 1 cut(s) 199
PdmI GAANNNNTTC 2 cut(s) 221, 236
PfeI GAWTC 3 cut(s) 243, 248, 286
Psp6I CCWGG 1 cut(s) 315
PspGI CCWGG 1 cut(s) 315
PstNI CAGNNNCTG 1 cut(s) 203
PsuI RGATCY 3 cut(s) 112, 126, 187
RsaI GTAC 2 cut(s) 61, 314
RsaNI GTAC 2 cut(s) 60, 313
Sau3AI GATC 6 cut(s) 4, 22, 112, 126, 156, 187
ScrFI CCNGG 1 cut(s) 317
SetI ASST 5 cut(s) 13, 57, 83, 136, 321
SexAI ACCWGGT 1 cut(s) 315
SgeI CNNG 9 cut(s) 20, 98, 121, 133, 157, 209, 280, 304, 310
SmlI CTYRAG 2 cut(s) 119, 290
SmoI CTYRAG 2 cut(s) 119, 290
Sse9I AATT 1 cut(s) 256
SspMI CTAG 1 cut(s) 86
StyD4I CCNGG 1 cut(s) 315
TaaI ACNGT 1 cut(s) 140
TaiI ACGT 1 cut(s) 57
TaqI TCGA 1 cut(s) 246
TasI AATT 1 cut(s) 256
TfiI GAWTC 3 cut(s) 243, 248, 286
TscAI CASTG 2 cut(s) 143, 204
TseFI GTSAC 1 cut(s) 199
Tsp45I GTSAC 1 cut(s) 199
TspDTI ATGAA 1 cut(s) 290
TspRI CASTG 2 cut(s) 143, 204
XmnI GAANNNNTTC 2 cut(s) 221, 236
XspI CTAG 1 cut(s) 86
ZraI GACGTC 1 cut(s) 55
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.