Rh1AG154900

Transcription elongation factor B polypeptide

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
28961400 .. 28961552
153 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG154900.1

Sequence Viewer

Length: 153 bp
ATGGATCAAGCTAACACCAATGATCCAAAGGGAAAGGCTCTGTCTTTCGCCGATGTCAGTATAGCCATAGATAATCGGATGTTTCTCGGCGATGTGAGTGACATGGACTTGGATCTTCTCCAGCAGATCTTACCTCACAGTTTCAAGACGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.54

Weight (kDa)

4.3

Isoelectric Point (pI)

15.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 12, 17, 120
AgsI TTSAA 1 cut(s) 145
AluBI AGCT 1 cut(s) 11
AluI AGCT 1 cut(s) 11
AlwI GGATC 3 cut(s) 12, 17, 120
BglII AGATCT 1 cut(s) 126
BpmI CTGGAG 1 cut(s) 104
BseGI GGATG 1 cut(s) 84
Bsp143I GATC 4 cut(s) 4, 22, 112, 126
BspPI GGATC 3 cut(s) 12, 17, 120
BssMI GATC 4 cut(s) 4, 22, 112, 126
Bst4CI ACNGT 1 cut(s) 140
BstF5I GGATG 1 cut(s) 84
BstKTI GATC 4 cut(s) 7, 25, 115, 129
BstMBI GATC 4 cut(s) 4, 22, 112, 126
BstX2I RGATCY 2 cut(s) 112, 126
BstYI RGATCY 2 cut(s) 112, 126
BtgZI GCGATG 1 cut(s) 105
BtsCI GGATG 1 cut(s) 84
CviAII CATG 1 cut(s) 103
CviJI RGCY 3 cut(s) 11, 38, 65
CviKI_1 RGCY 3 cut(s) 11, 38, 65
DpnI GATC 4 cut(s) 6, 24, 114, 128
DpnII GATC 4 cut(s) 4, 22, 112, 126
FaeI CATG 1 cut(s) 106
FaiI YATR 3 cut(s) 62, 68, 104
FatI CATG 1 cut(s) 102
FokI GGATG 1 cut(s) 91
GsuI CTGGAG 1 cut(s) 104
Hin1II CATG 1 cut(s) 106
Hpy188I TCNGA 1 cut(s) 78
Hpy188III TCNNGA 1 cut(s) 145
HpyCH4III ACNGT 1 cut(s) 140
HpyCH4IV ACGT 1 cut(s) 149
HpySE526I ACGT 1 cut(s) 149
Hsp92II CATG 1 cut(s) 106
Kzo9I GATC 4 cut(s) 4, 22, 112, 126
LpnPI CCDG 1 cut(s) 134
MaeII ACGT 1 cut(s) 149
MaeIII GTNAC 1 cut(s) 98
MalI GATC 4 cut(s) 6, 24, 114, 128
MboI GATC 4 cut(s) 4, 22, 112, 126
MboII GAAGA 1 cut(s) 107
MflI RGATCY 2 cut(s) 112, 126
MnlI CCTC 1 cut(s) 144
NdeII GATC 4 cut(s) 4, 22, 112, 126
NlaIII CATG 1 cut(s) 106
NmeAIII GCCGAG 1 cut(s) 66
NmuCI GTSAC 1 cut(s) 98
PsuI RGATCY 2 cut(s) 112, 126
Sau3AI GATC 4 cut(s) 4, 22, 112, 126
SetI ASST 3 cut(s) 13, 136, 152
SgeI CNNG 5 cut(s) 20, 98, 115, 121, 133
TaaI ACNGT 1 cut(s) 140
TaiI ACGT 1 cut(s) 152
TseFI GTSAC 1 cut(s) 98
Tsp45I GTSAC 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.