Rh1DG163100

Transcription elongation factor B polypeptide

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
OG0013655
Physical Location & Seq
Reverse (-)
33534273 .. 33534581
309 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG163100.1

Sequence Viewer

Length: 309 bp
ATGGATCAAGCTAACACCAATGATCAGAAGGGAAAGGCTCTGTCTTTCGCCGACATCAGTATGGCCATAGATAATCTGATGTTTCTCGGCGATGTAAGCAACATGGACTTGGATCTTCTAGAGCAGATCTTACCTCACAGTTTCAAGACGCAGTTGATCCATATAGAGAAGTCCACAAAAGACAGAGATCTGAGTCCAGTGACTAATAAGCTATGGAAGAGTGTCTATGAGAAGATCGAATCAACCGATTCAGTTTCAGAGATAATGAAGAAGTGGAATCTCAAATTTAAGTGGTCGGAGTTGTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Elongin_A

Protein Analysis

102

Amino Acids

11.84

Weight (kDa)

5.28

Isoelectric Point (pI)

36.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Elongin_A PF06881 30 - 102 8.9e-09 RNA polymerase II transcription factor SIII (Elongin) subunit A
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 12, 120, 151
AcoI YGGCCR 1 cut(s) 63
AcsI RAATTY 1 cut(s) 284
AfaI GTAC 1 cut(s) 305
AgsI TTSAA 1 cut(s) 145
AluBI AGCT 2 cut(s) 11, 211
AluI AGCT 2 cut(s) 11, 211
AlwI GGATC 3 cut(s) 12, 120, 151
AoxI GGCC 1 cut(s) 63
ApoI RAATTY 1 cut(s) 284
BalI TGGCCA 1 cut(s) 65
BclI TGATCA 1 cut(s) 22
BfaI CTAG 2 cut(s) 119, 307
BglII AGATCT 2 cut(s) 126, 187
Bse1I ACTGG 1 cut(s) 197
BseMII CTCAG 1 cut(s) 182
BseNI ACTGG 1 cut(s) 197
BshFI GGCC 1 cut(s) 65
BsnI GGCC 1 cut(s) 65
Bsp143I GATC 7 cut(s) 4, 22, 112, 126, 156, 187, 234
BspANI GGCC 1 cut(s) 65
BspCNI CTCAG 1 cut(s) 183
BspPI GGATC 3 cut(s) 12, 120, 151
BsrI ACTGG 1 cut(s) 197
BssMI GATC 7 cut(s) 4, 22, 112, 126, 156, 187, 234
Bst4CI ACNGT 1 cut(s) 140
Bst6I CTCTTC 1 cut(s) 212
BstDEI CTNAG 1 cut(s) 191
BstKTI GATC 7 cut(s) 7, 25, 115, 129, 159, 190, 237
BstMBI GATC 7 cut(s) 4, 22, 112, 126, 156, 187, 234
BstMWI GCNNNNNNNGC 1 cut(s) 96
BstX2I RGATCY 3 cut(s) 112, 126, 187
BstYI RGATCY 3 cut(s) 112, 126, 187
BsuRI GGCC 1 cut(s) 65
BtgZI GCGATG 1 cut(s) 105
BtsIMutI CAGTG 1 cut(s) 204
CseI GACGC 1 cut(s) 157
Csp6I GTAC 1 cut(s) 304
CviAII CATG 1 cut(s) 103
CviJI RGCY 4 cut(s) 11, 38, 65, 211
CviKI_1 RGCY 4 cut(s) 11, 38, 65, 211
CviQI GTAC 1 cut(s) 304
DdeI CTNAG 1 cut(s) 191
DpnI GATC 7 cut(s) 6, 24, 114, 128, 158, 189, 236
DpnII GATC 7 cut(s) 4, 22, 112, 126, 156, 187, 234
EaeI YGGCCR 1 cut(s) 63
Eam1104I CTCTTC 1 cut(s) 212
EarI CTCTTC 1 cut(s) 212
FaeI CATG 1 cut(s) 106
FaiI YATR 7 cut(s) 62, 68, 104, 162, 164, 214, 228
FatI CATG 1 cut(s) 102
FbaI TGATCA 1 cut(s) 22
FspBI CTAG 2 cut(s) 119, 307
HaeIII GGCC 1 cut(s) 65
HgaI GACGC 1 cut(s) 157
Hin1II CATG 1 cut(s) 106
HinfI GANTC 4 cut(s) 193, 239, 248, 277
Hpy166II GTNNAC 1 cut(s) 174
Hpy188I TCNGA 5 cut(s) 27, 78, 192, 259, 298
Hpy188III TCNNGA 2 cut(s) 119, 145
Hpy8I GTNNAC 1 cut(s) 174
HpyAV CCTTC 1 cut(s) 22
HpyCH4III ACNGT 1 cut(s) 140
HpyF10VI GCNNNNNNNGC 1 cut(s) 96
HpyF3I CTNAG 1 cut(s) 191
Hsp92II CATG 1 cut(s) 106
Ksp22I TGATCA 1 cut(s) 22
Kzo9I GATC 7 cut(s) 4, 22, 112, 126, 156, 187, 234
LpnPI CCDG 1 cut(s) 210
MaeI CTAG 2 cut(s) 119, 307
MaeIII GTNAC 1 cut(s) 199
MalI GATC 7 cut(s) 6, 24, 114, 128, 158, 189, 236
MboI GATC 7 cut(s) 4, 22, 112, 126, 156, 187, 234
MboII GAAGA 4 cut(s) 107, 229, 244, 280
MflI RGATCY 3 cut(s) 112, 126, 187
MlsI TGGCCA 1 cut(s) 65
MluCI AATT 1 cut(s) 284
MluNI TGGCCA 1 cut(s) 65
MlyI GAGTC 1 cut(s) 202
MmeI TCCRAC 1 cut(s) 276
MnlI CCTC 1 cut(s) 144
Mox20I TGGCCA 1 cut(s) 65
MscI TGGCCA 1 cut(s) 65
MseI TTAA 1 cut(s) 288
MslI CAYNNNNRTG 1 cut(s) 59
Msp20I TGGCCA 1 cut(s) 65
MwoI GCNNNNNNNGC 1 cut(s) 96
NdeII GATC 7 cut(s) 4, 22, 112, 126, 156, 187, 234
NlaIII CATG 1 cut(s) 106
NmeAIII GCCGAG 1 cut(s) 66
NmuCI GTSAC 1 cut(s) 199
PcsI WCGNNNNNNNCGW 1 cut(s) 243
PfeI GAWTC 3 cut(s) 239, 248, 277
PleI GAGTC 1 cut(s) 201
PpsI GAGTC 1 cut(s) 201
PsuI RGATCY 3 cut(s) 112, 126, 187
RsaI GTAC 1 cut(s) 305
RsaNI GTAC 1 cut(s) 304
RseI CAYNNNNRTG 1 cut(s) 59
SaqAI TTAA 1 cut(s) 288
Sau3AI GATC 7 cut(s) 4, 22, 112, 126, 156, 187, 234
SchI GAGTC 1 cut(s) 202
SetI ASST 3 cut(s) 13, 136, 213
SgeI CNNG 7 cut(s) 20, 98, 115, 121, 131, 157, 209
SmiMI CAYNNNNRTG 1 cut(s) 59
Sse9I AATT 1 cut(s) 284
SspMI CTAG 2 cut(s) 119, 307
TaaI ACNGT 1 cut(s) 140
TaqI TCGA 1 cut(s) 237
TasI AATT 1 cut(s) 284
TatI WGTACW 1 cut(s) 303
TfiI GAWTC 3 cut(s) 239, 248, 277
Tru1I TTAA 1 cut(s) 288
Tru9I TTAA 1 cut(s) 288
TscAI CASTG 1 cut(s) 204
TseFI GTSAC 1 cut(s) 199
Tsp45I GTSAC 1 cut(s) 199
TspDTI ATGAA 1 cut(s) 281
TspRI CASTG 1 cut(s) 204
XapI RAATTY 1 cut(s) 284
XbaI TCTAGA 1 cut(s) 118
XspI CTAG 2 cut(s) 119, 307
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.