RchiOBHm_Chr1g0356061

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
48621114 .. 48621856
743 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ58146

Sequence Viewer

Length: 192 bp
ATGTTTTCTTTGGTTACCGTTCCGCCTGGCATTTTCTTGCCTGGCGATCTGCTGATGGTGTTCGATGGCATGGCGTTTTGTCTGGTTTTGAGATTTGGTTGTTGGATTCTGCATGGGATTTGGACTGTTCACTGGTTGCAGTCCTCGTGGTGTCTCTGTATCACGCAATGGATCAGTTTGTGGCAGTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.32

Weight (kDa)

5.93

Isoelectric Point (pI)

48.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 23
AclWI GGATC 1 cut(s) 179
AjnI CCWGG 2 cut(s) 25, 40
Alw26I GTCTC 1 cut(s) 158
AlwI GGATC 1 cut(s) 179
BauI CACGAG 1 cut(s) 145
BccI CCATC 2 cut(s) 49, 59
BciT130I CCWGG 2 cut(s) 27, 42
BcoDI GTCTC 1 cut(s) 158
Bme1390I CCNGG 2 cut(s) 27, 42
BmrFI CCNGG 2 cut(s) 27, 42
Bse1I ACTGG 1 cut(s) 137
Bse3DI GCAATG 1 cut(s) 173
BseBI CCWGG 2 cut(s) 27, 42
BseMI GCAATG 1 cut(s) 173
BseNI ACTGG 1 cut(s) 137
BsmAI GTCTC 1 cut(s) 158
Bsp143I GATC 2 cut(s) 46, 171
BspACI CCGC 1 cut(s) 23
BspPI GGATC 1 cut(s) 179
BsrDI GCAATG 1 cut(s) 173
BsrI ACTGG 1 cut(s) 137
BssMI GATC 2 cut(s) 46, 171
BssSI CACGAG 1 cut(s) 145
Bst2BI CACGAG 1 cut(s) 145
Bst2UI CCWGG 2 cut(s) 27, 42
Bst4CI ACNGT 2 cut(s) 19, 127
BstEII GGTNACC 1 cut(s) 13
BstKTI GATC 2 cut(s) 49, 174
BstMAI GTCTC 1 cut(s) 158
BstMBI GATC 2 cut(s) 46, 171
BstNI CCWGG 2 cut(s) 27, 42
BstPI GGTNACC 1 cut(s) 13
BstSCI CCNGG 2 cut(s) 25, 40
BtsI GCAGTG 1 cut(s) 191
BtsIMutI CAGTG 2 cut(s) 130, 191
CviAII CATG 2 cut(s) 70, 113
DpnI GATC 2 cut(s) 48, 173
DpnII GATC 2 cut(s) 46, 171
EciI GGCGGA 1 cut(s) 12
Eco91I GGTNACC 1 cut(s) 13
EcoO65I GGTNACC 1 cut(s) 13
EcoRII CCWGG 2 cut(s) 25, 40
FaeI CATG 2 cut(s) 73, 116
FaiI YATR 2 cut(s) 71, 114
FatI CATG 2 cut(s) 69, 112
Hin1II CATG 2 cut(s) 73, 116
HinfI GANTC 1 cut(s) 106
Hpy166II GTNNAC 1 cut(s) 130
Hpy8I GTNNAC 1 cut(s) 130
HpyCH4III ACNGT 2 cut(s) 19, 127
HpyCH4V TGCA 2 cut(s) 112, 139
Hsp92II CATG 2 cut(s) 73, 116
Kzo9I GATC 2 cut(s) 46, 171
LpnPI CCDG 6 cut(s) 12, 27, 39, 54, 68, 118
MaeIII GTNAC 1 cut(s) 13
MalI GATC 2 cut(s) 48, 173
MboI GATC 2 cut(s) 46, 171
MmeI TCCRAC 1 cut(s) 83
MnlI CCTC 1 cut(s) 154
MspR9I CCNGG 2 cut(s) 27, 42
MvaI CCWGG 2 cut(s) 27, 42
NdeII GATC 2 cut(s) 46, 171
NlaIII CATG 2 cut(s) 73, 116
PfeI GAWTC 1 cut(s) 106
Psp6I CCWGG 2 cut(s) 25, 40
PspEI GGTNACC 1 cut(s) 13
PspGI CCWGG 2 cut(s) 25, 40
Sau3AI GATC 2 cut(s) 46, 171
ScrFI CCNGG 2 cut(s) 27, 42
SsiI CCGC 1 cut(s) 23
StyD4I CCNGG 2 cut(s) 25, 40
TaaI ACNGT 2 cut(s) 19, 127
TaqI TCGA 1 cut(s) 63
TfiI GAWTC 1 cut(s) 106
TscAI CASTG 2 cut(s) 137, 191
TspRI CASTG 2 cut(s) 137, 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.