RchiOBHm_Chr2g0106331

Belongs to the iron ascorbate-dependent oxidoreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0005695
Physical Location & Seq
Forward (+)
17760588 .. 17762245
1658 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ48042

Sequence Viewer

Length: 516 bp
ATGGCCACTGACTTCAAGTCCATACCCATAATTGATATTGGTCCTCTTCTGGCCAAGTGTGATGATCCCAAAATGGGTCAAGACCCAGGTGTTGCTCATGTAGTCAAGCAATTAGATCAAGCTTGTAAAGAAGCAGGCTTCTTCTATGTGAAAGGCCATGGTGTTCCTGAGACTCTGTTAAAAGAAGTCAAGAATCTGACCCGCAAGTTCTTTGAACTTCCATATGAGGAAAAAGCCAAGATCAAGATGACTGCTGATAAAGGATACAGAGGGTATCAGAGAATTGGGGAGAATATAACCAAAGGTGTACCAGACATACATGAAGCAATTGATTGCTATAAAGAAGTGAAACCAGGAATGTACGGAGATCTTGGAAAACCTATGGAAGGATGTAACCAATGGCCAACTAATCCCCCAAACTTCAAGCTACTGATGGAGGAATATATCAGCCTCTGCACAGGCATGCTTTCCTCAACAAACCAACTTCTCACTGTTTATCATTCCATGTTCTCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0006950 GO:0007154 GO:0008150 GO:0009267 GO:0009605 GO:0009987 GO:0009991 GO:0031667 GO:0031668 GO:0031669 GO:0033554 GO:0042594 GO:0050896 GO:0051716 GO:0071496
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
2OG-FeII_Oxy DIOX_N

Protein Analysis

171

Amino Acids

19.21

Weight (kDa)

6.42

Isoelectric Point (pI)

20.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DIOX_N PF14226 8 - 137 1.7e-32 non-haem dioxygenase in morphine synthesis N-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 202
AclWI GGATC 1 cut(s) 59
AcoI YGGCCR 3 cut(s) 3, 51, 401
AfaI GTAC 2 cut(s) 309, 362
AfiI CCNNNNNNNGG 2 cut(s) 74, 386
AgsI TTSAA 3 cut(s) 16, 215, 424
AhdI GACNNNNNGTC 1 cut(s) 16
AjnI CCWGG 2 cut(s) 85, 352
AluBI AGCT 2 cut(s) 122, 427
AluI AGCT 2 cut(s) 122, 427
Alw26I GTCTC 1 cut(s) 164
AlwI GGATC 1 cut(s) 59
AlwNI CAGNNNCTG 1 cut(s) 453
AoxI GGCC 4 cut(s) 3, 51, 154, 401
AspS9I GGNCC 1 cut(s) 41
AvaII GGWCC 1 cut(s) 41
BalI TGGCCA 3 cut(s) 5, 53, 403
BccI CCATC 1 cut(s) 427
BciT130I CCWGG 2 cut(s) 87, 354
BciVI GTATCC 1 cut(s) 257
BcoDI GTCTC 1 cut(s) 164
BfaI CTAG 1 cut(s) 514
BfuI GTATCC 1 cut(s) 257
BglII AGATCT 1 cut(s) 367
Bme1390I CCNGG 2 cut(s) 87, 354
Bme18I GGWCC 1 cut(s) 41
BmeRI GACNNNNNGTC 1 cut(s) 16
BmgT120I GGNCC 1 cut(s) 41
BmrFI CCNGG 2 cut(s) 87, 354
BsaJI CCNNGG 2 cut(s) 85, 157
Bsc4I CCNNNNNNNGG 2 cut(s) 74, 386
BseBI CCWGG 2 cut(s) 87, 354
BseDI CCNNGG 2 cut(s) 85, 157
BseGI GGATG 1 cut(s) 395
BseLI CCNNNNNNNGG 2 cut(s) 74, 386
BseMII CTCAG 1 cut(s) 159
BsgI GTGCAG 1 cut(s) 439
BshFI GGCC 4 cut(s) 5, 53, 156, 403
BslI CCNNNNNNNGG 2 cut(s) 74, 386
BsmAI GTCTC 1 cut(s) 164
BsnI GGCC 4 cut(s) 5, 53, 156, 403
Bsp143I GATC 4 cut(s) 64, 115, 240, 367
Bsp19I CCATGG 1 cut(s) 157
BspACI CCGC 1 cut(s) 202
BspANI GGCC 4 cut(s) 5, 53, 156, 403
BspCNI CTCAG 1 cut(s) 160
BspPI GGATC 1 cut(s) 59
BssECI CCNNGG 2 cut(s) 85, 157
BssMI GATC 4 cut(s) 64, 115, 240, 367
BssT1I CCWWGG 1 cut(s) 157
Bst2UI CCWGG 2 cut(s) 87, 354
Bst4CI ACNGT 1 cut(s) 493
Bst6I CTCTTC 1 cut(s) 51
BstC8I GCNNGC 2 cut(s) 136, 464
BstDEI CTNAG 1 cut(s) 168
BstDSI CCRYGG 1 cut(s) 157
BstENI CCTNNNNNAGG 1 cut(s) 384
BstF5I GGATG 1 cut(s) 395
BstKTI GATC 4 cut(s) 67, 118, 243, 370
BstMAI GTCTC 1 cut(s) 164
BstMBI GATC 4 cut(s) 64, 115, 240, 367
BstNI CCWGG 2 cut(s) 87, 354
BstNSI RCATGY 1 cut(s) 466
BstSCI CCNGG 2 cut(s) 85, 352
BstX2I RGATCY 1 cut(s) 367
BstYI RGATCY 1 cut(s) 367
BsuI GTATCC 1 cut(s) 257
BsuRI GGCC 4 cut(s) 5, 53, 156, 403
BtgI CCRYGG 1 cut(s) 157
BtsCI GGATG 1 cut(s) 395
BtsIMutI CAGTG 2 cut(s) 6, 489
Cac8I GCNNGC 2 cut(s) 136, 464
CaiI CAGNNNCTG 1 cut(s) 453
Cfr13I GGNCC 1 cut(s) 41
Csp6I GTAC 2 cut(s) 308, 361
CviAII CATG 5 cut(s) 98, 158, 320, 463, 505
CviJI RGCY 9 cut(s) 5, 53, 122, 138, 156, 236, 403, 427, 450
CviKI_1 RGCY 9 cut(s) 5, 53, 122, 138, 156, 236, 403, 427, 450
CviQI GTAC 2 cut(s) 308, 361
DdeI CTNAG 1 cut(s) 168
DpnI GATC 4 cut(s) 66, 117, 242, 369
DpnII GATC 4 cut(s) 64, 115, 240, 367
DriI GACNNNNNGTC 1 cut(s) 16
EaeI YGGCCR 3 cut(s) 3, 51, 401
Eam1104I CTCTTC 1 cut(s) 51
Eam1105I GACNNNNNGTC 1 cut(s) 16
EarI CTCTTC 1 cut(s) 51
Eco130I CCWWGG 1 cut(s) 157
Eco47I GGWCC 1 cut(s) 41
EcoNI CCTNNNNNAGG 1 cut(s) 384
EcoRII CCWGG 2 cut(s) 85, 352
EcoT14I CCWWGG 1 cut(s) 157
ErhI CCWWGG 1 cut(s) 157
FaeI CATG 5 cut(s) 101, 161, 323, 466, 508
FatI CATG 5 cut(s) 97, 157, 319, 462, 504
FauI CCCGC 1 cut(s) 209
FauNDI CATATG 1 cut(s) 223
FokI GGATG 1 cut(s) 402
FspBI CTAG 1 cut(s) 514
HaeIII GGCC 4 cut(s) 5, 53, 156, 403
Hin1II CATG 5 cut(s) 101, 161, 323, 466, 508
HindIII AAGCTT 1 cut(s) 120
HinfI GANTC 2 cut(s) 172, 193
Hpy166II GTNNAC 1 cut(s) 308
Hpy188I TCNGA 2 cut(s) 198, 279
Hpy188III TCNNGA 4 cut(s) 80, 167, 190, 244
Hpy8I GTNNAC 1 cut(s) 308
HpyAV CCTTC 1 cut(s) 380
HpyCH4III ACNGT 1 cut(s) 493
HpyCH4V TGCA 1 cut(s) 456
HpyF3I CTNAG 1 cut(s) 168
Hsp92II CATG 5 cut(s) 101, 161, 323, 466, 508
Kzo9I GATC 4 cut(s) 64, 115, 240, 367
LpnPI CCDG 9 cut(s) 35, 72, 99, 120, 180, 324, 339, 366, 444
MaeI CTAG 1 cut(s) 514
MaeIII GTNAC 1 cut(s) 392
MalI GATC 4 cut(s) 66, 117, 242, 369
MboI GATC 4 cut(s) 64, 115, 240, 367
MboII GAAGA 2 cut(s) 38, 133
MfeI CAATTG 1 cut(s) 327
MflI RGATCY 1 cut(s) 367
MlsI TGGCCA 3 cut(s) 5, 53, 403
MluCI AATT 4 cut(s) 30, 110, 282, 327
MluNI TGGCCA 3 cut(s) 5, 53, 403
MlyI GAGTC 1 cut(s) 166
MnlI CCTC 6 cut(s) 54, 220, 263, 430, 461, 481
Mox20I TGGCCA 3 cut(s) 5, 53, 403
MscI TGGCCA 3 cut(s) 5, 53, 403
MseI TTAA 1 cut(s) 179
MslI CAYNNNNRTG 1 cut(s) 461
Msp20I TGGCCA 3 cut(s) 5, 53, 403
MspR9I CCNGG 2 cut(s) 87, 354
MunI CAATTG 1 cut(s) 327
MvaI CCWGG 2 cut(s) 87, 354
NcoI CCATGG 1 cut(s) 157
NdeI CATATG 1 cut(s) 223
NdeII GATC 4 cut(s) 64, 115, 240, 367
NlaIII CATG 5 cut(s) 101, 161, 323, 466, 508
NspI RCATGY 1 cut(s) 466
PaeI GCATGC 1 cut(s) 466
PfeI GAWTC 1 cut(s) 193
PleI GAGTC 1 cut(s) 166
PpsI GAGTC 1 cut(s) 166
Psp6I CCWGG 2 cut(s) 85, 352
PspGI CCWGG 2 cut(s) 85, 352
PspPI GGNCC 1 cut(s) 41
PstNI CAGNNNCTG 1 cut(s) 453
PsuI RGATCY 1 cut(s) 367
RsaI GTAC 2 cut(s) 309, 362
RsaNI GTAC 2 cut(s) 308, 361
RseI CAYNNNNRTG 1 cut(s) 461
SaqAI TTAA 1 cut(s) 179
Sau3AI GATC 4 cut(s) 64, 115, 240, 367
Sau96I GGNCC 1 cut(s) 41
SchI GAGTC 1 cut(s) 166
ScrFI CCNGG 2 cut(s) 87, 354
SetI ASST 5 cut(s) 91, 124, 307, 382, 429
SinI GGWCC 1 cut(s) 41
SmiMI CAYNNNNRTG 1 cut(s) 461
SphI GCATGC 1 cut(s) 466
Sse9I AATT 4 cut(s) 30, 110, 282, 327
SsiI CCGC 1 cut(s) 202
SspMI CTAG 1 cut(s) 514
StyD4I CCNGG 2 cut(s) 85, 352
StyI CCWWGG 1 cut(s) 157
TaaI ACNGT 1 cut(s) 493
TasI AATT 4 cut(s) 30, 110, 282, 327
TfiI GAWTC 1 cut(s) 193
Tru1I TTAA 1 cut(s) 179
Tru9I TTAA 1 cut(s) 179
TscAI CASTG 2 cut(s) 13, 496
TspDTI ATGAA 1 cut(s) 336
TspGWI ACGGA 1 cut(s) 378
TspRI CASTG 2 cut(s) 13, 496
VpaK11BI GGWCC 1 cut(s) 41
XagI CCTNNNNNAGG 1 cut(s) 384
XceI RCATGY 1 cut(s) 466
XspI CTAG 1 cut(s) 514
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.