RchiOBHm_Chr2g0113431

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0001744
Physical Location & Seq
Reverse (-)
25582512 .. 25583012
501 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ48678

Sequence Viewer

Length: 246 bp
ATGGCCATAGGTGGAATATACAACCATCCGATCCAAGATTCTCCCCCTACTAGCTCCAAGGTGGAGGAGACCTTGGAGGAGGATCTTGATGACAGAGAGAAGCACCTCGAGAACACGAAAGAGTCCTCCTTCCCTTCTTCAGTGTTTTTGGTGCTTCCCAAAGCTCCACGCTTGCTCAGAGCCTCTGAAGCAAACCTTTTAAAATCTCATAGTAAATCAATACCTGAAAAAGTACTGCATGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

9.01

Weight (kDa)

5.74

Isoelectric Point (pI)

54.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 25, 90
AcoI YGGCCR 1 cut(s) 3
AcuI CTGAAG 2 cut(s) 123, 207
AfaI GTAC 1 cut(s) 234
AluBI AGCT 2 cut(s) 54, 164
AluI AGCT 2 cut(s) 54, 164
Alw26I GTCTC 1 cut(s) 62
AlwI GGATC 2 cut(s) 25, 90
Ama87I CYCGRG 1 cut(s) 107
AoxI GGCC 1 cut(s) 3
AvaI CYCGRG 1 cut(s) 107
BalI TGGCCA 1 cut(s) 5
BccI CCATC 1 cut(s) 33
BcoDI GTCTC 1 cut(s) 62
BfaI CTAG 1 cut(s) 51
BmcAI AGTACT 1 cut(s) 234
BmeT110I CYCGRG 1 cut(s) 107
BsaI GGTCTC 1 cut(s) 62
BsaJI CCNNGG 2 cut(s) 57, 72
BseDI CCNNGG 2 cut(s) 57, 72
BseGI GGATG 1 cut(s) 25
BseMII CTCAG 1 cut(s) 190
BseRI GAGGAG 2 cut(s) 80, 92
BshFI GGCC 1 cut(s) 5
BsiHKCI CYCGRG 1 cut(s) 107
BsmAI GTCTC 1 cut(s) 62
BsnI GGCC 1 cut(s) 5
Bso31I GGTCTC 1 cut(s) 62
BsoBI CYCGRG 1 cut(s) 107
Bsp143I GATC 2 cut(s) 30, 82
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 189
BspPI GGATC 2 cut(s) 25, 90
BspTNI GGTCTC 1 cut(s) 62
BssECI CCNNGG 2 cut(s) 57, 72
BssMI GATC 2 cut(s) 30, 82
BssT1I CCWWGG 2 cut(s) 57, 72
BstC8I GCNNGC 2 cut(s) 173, 240
BstDEI CTNAG 1 cut(s) 176
BstF5I GGATG 1 cut(s) 25
BstKTI GATC 2 cut(s) 33, 85
BstMAI GTCTC 1 cut(s) 62
BstMBI GATC 2 cut(s) 30, 82
BstMWI GCNNNNNNNGC 1 cut(s) 188
BstNSI RCATGY 1 cut(s) 242
BstX2I RGATCY 1 cut(s) 82
BstYI RGATCY 1 cut(s) 82
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 25
BtsIMutI CAGTG 1 cut(s) 147
Cac8I GCNNGC 2 cut(s) 173, 240
Csp6I GTAC 1 cut(s) 233
CviAII CATG 1 cut(s) 239
CviJI RGCY 4 cut(s) 5, 54, 164, 182
CviKI_1 RGCY 4 cut(s) 5, 54, 164, 182
CviQI GTAC 1 cut(s) 233
DdeI CTNAG 1 cut(s) 176
DpnI GATC 2 cut(s) 32, 84
DpnII GATC 2 cut(s) 30, 82
DraI TTTAAA 1 cut(s) 201
EaeI YGGCCR 1 cut(s) 3
Eco130I CCWWGG 2 cut(s) 57, 72
Eco31I GGTCTC 1 cut(s) 62
Eco57I CTGAAG 2 cut(s) 123, 207
Eco88I CYCGRG 1 cut(s) 107
EcoT14I CCWWGG 2 cut(s) 57, 72
EcoT22I ATGCAT 1 cut(s) 244
ErhI CCWWGG 2 cut(s) 57, 72
FaeI CATG 1 cut(s) 242
FaiI YATR 5 cut(s) 8, 19, 210, 240, 244
FalI AAGNNNNNCTT 2 cut(s) 180, 212
FatI CATG 1 cut(s) 238
FokI GGATG 1 cut(s) 12
FspBI CTAG 1 cut(s) 51
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 1 cut(s) 242
HinfI GANTC 2 cut(s) 38, 122
Hpy188I TCNGA 3 cut(s) 30, 179, 187
Hpy188III TCNNGA 2 cut(s) 86, 109
HpyAV CCTTC 2 cut(s) 139, 144
HpyCH4V TGCA 2 cut(s) 238, 242
HpyF10VI GCNNNNNNNGC 1 cut(s) 188
HpyF3I CTNAG 1 cut(s) 176
Hsp92II CATG 1 cut(s) 242
Kzo9I GATC 2 cut(s) 30, 82
LmnI GCTCC 2 cut(s) 59, 169
LpnPI CCDG 1 cut(s) 237
MaeI CTAG 1 cut(s) 51
MalI GATC 2 cut(s) 32, 84
MboI GATC 2 cut(s) 30, 82
MboII GAAGA 1 cut(s) 129
MflI RGATCY 1 cut(s) 82
MlsI TGGCCA 1 cut(s) 5
MluNI TGGCCA 1 cut(s) 5
MlyI GAGTC 1 cut(s) 131
MnlI CCTC 6 cut(s) 58, 70, 73, 116, 136, 193
Mox20I TGGCCA 1 cut(s) 5
Mph1103I ATGCAT 1 cut(s) 244
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 200
Msp20I TGGCCA 1 cut(s) 5
MwoI GCNNNNNNNGC 1 cut(s) 188
NdeII GATC 2 cut(s) 30, 82
NlaIII CATG 1 cut(s) 242
NsiI ATGCAT 1 cut(s) 244
NspI RCATGY 1 cut(s) 242
PaeI GCATGC 1 cut(s) 242
PaeR7I CTCGAG 1 cut(s) 107
PfeI GAWTC 1 cut(s) 38
PleI GAGTC 1 cut(s) 130
PpsI GAGTC 1 cut(s) 130
PsuI RGATCY 1 cut(s) 82
RsaI GTAC 1 cut(s) 234
RsaNI GTAC 1 cut(s) 233
SaqAI TTAA 1 cut(s) 200
Sau3AI GATC 2 cut(s) 30, 82
ScaI AGTACT 1 cut(s) 234
SchI GAGTC 1 cut(s) 131
SetI ASST 8 cut(s) 13, 56, 63, 74, 108, 166, 198, 226
Sfr274I CTCGAG 1 cut(s) 107
SlaI CTCGAG 1 cut(s) 107
SmlI CTYRAG 1 cut(s) 107
SmoI CTYRAG 1 cut(s) 107
SphI GCATGC 1 cut(s) 242
SspMI CTAG 1 cut(s) 51
StyI CCWWGG 2 cut(s) 57, 72
TaqI TCGA 1 cut(s) 108
TatI WGTACW 1 cut(s) 232
TfiI GAWTC 1 cut(s) 38
Tru1I TTAA 1 cut(s) 200
Tru9I TTAA 1 cut(s) 200
TscAI CASTG 1 cut(s) 147
TspRI CASTG 1 cut(s) 147
XceI RCATGY 1 cut(s) 242
XhoI CTCGAG 1 cut(s) 107
XspI CTAG 1 cut(s) 51
ZrmI AGTACT 1 cut(s) 234
Zsp2I ATGCAT 1 cut(s) 244
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.