RchiOBHm_Chr2g0128191

Mitochondrial ribosomal subunit protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
43150524 .. 43153112
2589 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49999

Sequence Viewer

Length: 432 bp
ATGAAAAGAGACATAGATGACCCACTGGGTGAAGGGCCAATCCTTAGGTGGCAAACACGAGTGGTCTTTGCTCCTGGTGGTGATGCTTGGCATCCAAAGAATAGAAAAGTGAAGCTGTCTGTTACGGTGAAAGAACTCGGGCTTTCAAAGCATCAATTCCGTCGGCTCAGAGAATTGGTTGGAAAGCGATACAATCCAGGGAAAGATGAGCTCACTATTACTAGTGAGAGGTTTGAACACCGAGAGGAAAATAGAAAGGATTGCCTTAGGACTCTTCTTTCCCTCATTGAGGAAGCTGAGAAAGCTAACAAGCTGGCCGAGGATGCTAGAGTTTTGTATGTCAAGGAGAGATTAAGAGAAAATCCTGCATTCATGGAGAGACTGCGTAACAAGACAATGAGATTGCAAGGACATACCACAGTGACAGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

143

Amino Acids

16.77

Weight (kDa)

9.94

Isoelectric Point (pI)

44.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
MRP-S28 PF10213 29 - 108 1.1e-18 Mitochondrial ribosomal subunit protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 315
AdeI CACNNNGTG 1 cut(s) 29
AfiI CCNNNNNNNGG 1 cut(s) 289
AgsI TTSAA 2 cut(s) 147, 236
AhlI ACTAGT 1 cut(s) 221
AjnI CCWGG 2 cut(s) 73, 196
AluBI AGCT 6 cut(s) 115, 211, 296, 305, 313, 428
AluI AGCT 6 cut(s) 115, 211, 296, 305, 313, 428
Alw21I GWGCWC 1 cut(s) 213
Alw26I GTCTC 2 cut(s) 3, 373
Ama87I CYCGRG 1 cut(s) 137
AoxI GGCC 2 cut(s) 35, 315
AspS9I GGNCC 1 cut(s) 35
AsuHPI GGTGA 3 cut(s) 41, 92, 139
AvaI CYCGRG 1 cut(s) 137
AxyI CCTNAGG 2 cut(s) 44, 266
BanII GRGCYC 1 cut(s) 213
BauI CACGAG 1 cut(s) 57
Bbv12I GWGCWC 1 cut(s) 213
BciT130I CCWGG 2 cut(s) 75, 198
BcoDI GTCTC 2 cut(s) 3, 373
BcuI ACTAGT 1 cut(s) 221
BfaI CTAG 2 cut(s) 222, 327
Bme1390I CCNGG 2 cut(s) 75, 198
BmeT110I CYCGRG 1 cut(s) 137
BmgT120I GGNCC 1 cut(s) 35
BmrFI CCNGG 2 cut(s) 75, 198
BmrI ACTGGG 1 cut(s) 35
BmsI GCATC 4 cut(s) 73, 100, 160, 313
BmuI ACTGGG 1 cut(s) 35
BsaJI CCNNGG 2 cut(s) 197, 318
Bsc4I CCNNNNNNNGG 1 cut(s) 289
Bse1I ACTGG 1 cut(s) 30
Bse21I CCTNAGG 2 cut(s) 44, 266
BseBI CCWGG 2 cut(s) 75, 198
BseDI CCNNGG 2 cut(s) 197, 318
BseGI GGATG 2 cut(s) 91, 328
BseLI CCNNNNNNNGG 1 cut(s) 289
BseMII CTCAG 2 cut(s) 181, 288
BseNI ACTGG 1 cut(s) 30
BshFI GGCC 2 cut(s) 37, 317
BsiHKAI GWGCWC 1 cut(s) 213
BsiHKCI CYCGRG 1 cut(s) 137
BslI CCNNNNNNNGG 1 cut(s) 289
BsmAI GTCTC 2 cut(s) 3, 373
BsmI GAATGC 1 cut(s) 368
BsnI GGCC 2 cut(s) 37, 317
BsoBI CYCGRG 1 cut(s) 137
Bsp1286I GDGCHC 1 cut(s) 213
BspANI GGCC 2 cut(s) 37, 317
BspCNI CTCAG 2 cut(s) 180, 289
BsrI ACTGG 1 cut(s) 30
BssECI CCNNGG 2 cut(s) 197, 318
BssSI CACGAG 1 cut(s) 57
Bst2BI CACGAG 1 cut(s) 57
Bst2UI CCWGG 2 cut(s) 75, 198
Bst4CI ACNGT 2 cut(s) 127, 421
Bst6I CTCTTC 1 cut(s) 279
BstC8I GCNNGC 1 cut(s) 315
BstDEI CTNAG 4 cut(s) 44, 167, 266, 297
BstENI CCTNNNNNAGG 1 cut(s) 287
BstF5I GGATG 2 cut(s) 91, 328
BstMAI GTCTC 2 cut(s) 3, 373
BstMWI GCNNNNNNNGC 3 cut(s) 148, 302, 323
BstNI CCWGG 2 cut(s) 75, 198
BstSCI CCNGG 2 cut(s) 73, 196
Bsu36I CCTNAGG 2 cut(s) 44, 266
BsuRI GGCC 2 cut(s) 37, 317
BtsCI GGATG 2 cut(s) 91, 328
BtsIMutI CAGTG 2 cut(s) 23, 426
Cac8I GCNNGC 1 cut(s) 315
Cfr13I GGNCC 1 cut(s) 35
CviAII CATG 1 cut(s) 373
DdeI CTNAG 4 cut(s) 44, 167, 266, 297
DraIII CACNNNGTG 1 cut(s) 29
EaeI YGGCCR 1 cut(s) 315
Eam1104I CTCTTC 1 cut(s) 279
EarI CTCTTC 1 cut(s) 279
Ecl136II GAGCTC 1 cut(s) 211
Eco24I GRGCYC 1 cut(s) 213
Eco53kI GAGCTC 1 cut(s) 211
Eco81I CCTNAGG 2 cut(s) 44, 266
Eco88I CYCGRG 1 cut(s) 137
EcoICRI GAGCTC 1 cut(s) 211
EcoNI CCTNNNNNAGG 1 cut(s) 287
EcoRII CCWGG 2 cut(s) 73, 196
EcoT38I GRGCYC 1 cut(s) 213
FaeI CATG 1 cut(s) 376
FaiI YATR 4 cut(s) 14, 339, 374, 414
FatI CATG 1 cut(s) 372
FokI GGATG 2 cut(s) 78, 335
FriOI GRGCYC 1 cut(s) 213
FspBI CTAG 2 cut(s) 222, 327
HaeIII GGCC 2 cut(s) 37, 317
Hin1II CATG 1 cut(s) 376
HinfI GANTC 1 cut(s) 271
HphI GGTGA 3 cut(s) 41, 92, 139
Hpy188I TCNGA 1 cut(s) 170
Hpy99I CGWCG 1 cut(s) 165
HpyAV CCTTC 1 cut(s) 26
HpyCH4III ACNGT 2 cut(s) 127, 421
HpyCH4V TGCA 2 cut(s) 368, 406
HpyF10VI GCNNNNNNNGC 3 cut(s) 148, 302, 323
HpyF3I CTNAG 4 cut(s) 44, 167, 266, 297
Hsp92II CATG 1 cut(s) 376
LmnI GCTCC 1 cut(s) 76
LpnPI CCDG 7 cut(s) 11, 60, 87, 183, 210, 299, 378
LweI GCATC 4 cut(s) 73, 100, 160, 313
MaeI CTAG 2 cut(s) 222, 327
MaeIII GTNAC 3 cut(s) 121, 386, 421
MboII GAAGA 1 cut(s) 266
MhlI GDGCHC 1 cut(s) 213
MluCI AATT 2 cut(s) 155, 173
MlyI GAGTC 1 cut(s) 265
MmeI TCCRAC 1 cut(s) 160
MnlI CCTC 5 cut(s) 222, 238, 283, 293, 313
MseI TTAA 1 cut(s) 353
MspR9I CCNGG 2 cut(s) 75, 198
Mva1269I GAATGC 1 cut(s) 368
MvaI CCWGG 2 cut(s) 75, 198
MwoI GCNNNNNNNGC 3 cut(s) 148, 302, 323
NlaIII CATG 1 cut(s) 376
NmeAIII GCCGAG 1 cut(s) 343
NmuCI GTSAC 1 cut(s) 421
PctI GAATGC 1 cut(s) 368
PleI GAGTC 1 cut(s) 265
PpsI GAGTC 1 cut(s) 265
Psp124BI GAGCTC 1 cut(s) 213
Psp6I CCWGG 2 cut(s) 73, 196
PspGI CCWGG 2 cut(s) 73, 196
PspPI GGNCC 1 cut(s) 35
SacI GAGCTC 1 cut(s) 213
SaqAI TTAA 1 cut(s) 353
Sau96I GGNCC 1 cut(s) 35
SchI GAGTC 1 cut(s) 265
ScrFI CCNGG 2 cut(s) 75, 198
SduI GDGCHC 1 cut(s) 213
SetI ASST 8 cut(s) 50, 117, 213, 233, 298, 307, 315, 430
SfaNI GCATC 4 cut(s) 73, 100, 160, 313
SpeI ACTAGT 1 cut(s) 221
Sse9I AATT 2 cut(s) 155, 173
SspMI CTAG 2 cut(s) 222, 327
SstI GAGCTC 1 cut(s) 213
StyD4I CCNGG 2 cut(s) 73, 196
TaaI ACNGT 2 cut(s) 127, 421
TasI AATT 2 cut(s) 155, 173
Tru1I TTAA 1 cut(s) 353
Tru9I TTAA 1 cut(s) 353
TscAI CASTG 2 cut(s) 30, 426
TseFI GTSAC 1 cut(s) 421
Tsp45I GTSAC 1 cut(s) 421
TspDTI ATGAA 2 cut(s) 17, 361
TspGWI ACGGA 1 cut(s) 149
TspRI CASTG 2 cut(s) 30, 426
XagI CCTNNNNNAGG 1 cut(s) 287
XcmI CCANNNNNNNNNTGG 1 cut(s) 45
XspI CTAG 2 cut(s) 222, 327
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.