RchiOBHm_Chr2g0145041

Thioredoxin

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
62626114 .. 62626329
216 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51491

Sequence Viewer

Length: 216 bp
ATGATCCACCCTATAATTGATGAACTGGAAAAGCAATATGCTGGGAAGCTCAAATGTTACAAAGTAAGCACCGATGAGAGTGCTTCAGTTGCAACCCGATATGGGATCCGAAGCATCCCCACTGTCATCTTATTCAAGGATGGTGAGAAAAAAGAAGCAGTTATTGGGGCTGTTCCCAAATCCACATTAACCACCAGCATAGAAAAGTTCTTGTAG

Protein Analysis

71

Amino Acids

7.86

Weight (kDa)

8.76

Isoelectric Point (pI)

24.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Thioredoxin PF00085 1 - 68 1.3e-13 Thioredoxin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 100, 113
AcuI CTGAAG 1 cut(s) 69
AfiI CCNNNNNNNGG 1 cut(s) 102
AgsI TTSAA 1 cut(s) 136
AjuI GAANNNNNNNTTGG 2 cut(s) 147, 179
AluBI AGCT 1 cut(s) 49
AluI AGCT 1 cut(s) 49
AlwI GGATC 2 cut(s) 100, 113
AsuHPI GGTGA 1 cut(s) 155
BamHI GGATCC 1 cut(s) 105
BccI CCATC 1 cut(s) 134
BcgI CGANNNNNNTGC 2 cut(s) 62, 96
BmiI GGNNCC 1 cut(s) 107
BmsI GCATC 1 cut(s) 123
Bsc4I CCNNNNNNNGG 1 cut(s) 102
Bse1I ACTGG 1 cut(s) 30
BseGI GGATG 2 cut(s) 114, 145
BseLI CCNNNNNNNGG 1 cut(s) 102
BseNI ACTGG 1 cut(s) 30
BseYI CCCAGC 1 cut(s) 41
BslI CCNNNNNNNGG 1 cut(s) 102
Bsp143I GATC 2 cut(s) 3, 105
BspLI GGNNCC 1 cut(s) 107
BspPI GGATC 2 cut(s) 100, 113
BsrI ACTGG 1 cut(s) 30
BssMI GATC 2 cut(s) 3, 105
Bst4CI ACNGT 1 cut(s) 124
BstF5I GGATG 2 cut(s) 114, 145
BstKTI GATC 2 cut(s) 6, 108
BstMBI GATC 2 cut(s) 3, 105
BstMWI GCNNNNNNNGC 1 cut(s) 89
BstX2I RGATCY 1 cut(s) 105
BstYI RGATCY 1 cut(s) 105
BtsCI GGATG 2 cut(s) 114, 145
BtsIMutI CAGTG 1 cut(s) 120
CviJI RGCY 2 cut(s) 49, 170
CviKI_1 RGCY 2 cut(s) 49, 170
DpnI GATC 2 cut(s) 5, 107
DpnII GATC 2 cut(s) 3, 105
Eco57I CTGAAG 1 cut(s) 69
FaiI YATR 4 cut(s) 14, 39, 102, 200
FokI GGATG 2 cut(s) 101, 152
GsaI CCCAGC 1 cut(s) 45
HphI GGTGA 1 cut(s) 155
Hpy188I TCNGA 1 cut(s) 110
HpyCH4III ACNGT 1 cut(s) 124
HpyCH4V TGCA 1 cut(s) 92
HpyF10VI GCNNNNNNNGC 1 cut(s) 89
Kzo9I GATC 2 cut(s) 3, 105
LpnPI CCDG 3 cut(s) 11, 27, 208
LweI GCATC 1 cut(s) 123
MaeIII GTNAC 1 cut(s) 56
MalI GATC 2 cut(s) 5, 107
MboI GATC 2 cut(s) 3, 105
MflI RGATCY 1 cut(s) 105
MluCI AATT 1 cut(s) 15
MseI TTAA 1 cut(s) 188
MwoI GCNNNNNNNGC 1 cut(s) 89
NdeII GATC 2 cut(s) 3, 105
NlaIV GGNNCC 1 cut(s) 107
PspFI CCCAGC 1 cut(s) 41
PspN4I GGNNCC 1 cut(s) 107
PsuI RGATCY 1 cut(s) 105
SaqAI TTAA 1 cut(s) 188
Sau3AI GATC 2 cut(s) 3, 105
SetI ASST 1 cut(s) 51
SfaNI GCATC 1 cut(s) 123
SgeI CNNG 5 cut(s) 38, 54, 108, 148, 207
Sse9I AATT 1 cut(s) 15
TaaI ACNGT 1 cut(s) 124
TasI AATT 1 cut(s) 15
Tru1I TTAA 1 cut(s) 188
Tru9I TTAA 1 cut(s) 188
TscAI CASTG 1 cut(s) 127
TspDTI ATGAA 1 cut(s) 36
TspRI CASTG 1 cut(s) 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.