RchiOBHm_Chr3g0459641

Protein kinase domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0016409
Physical Location & Seq
Reverse (-)
8029327 .. 8029564
238 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ42623

Sequence Viewer

Length: 150 bp
ATGAACATAATATACATATGGACACTCTTCTATGGCCCGACCATGGATATTTGGGCTTGTGGCTGCATTTTAGCTGAAATGGTTTTGGGTGGACCCATCTTTAGTGGCAATTCAGAGGCTAACCAGCTCTTCATTATCTTCAGGTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pkinase

Protein Analysis

49

Amino Acids

5.59

Weight (kDa)

4.14

Isoelectric Point (pI)

32.09

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pkinase PF00069 11 - 42 5.5e-07 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 124
AfiI CCNNNNNNNGG 1 cut(s) 43
AluBI AGCT 2 cut(s) 74, 127
AluI AGCT 2 cut(s) 74, 127
AoxI GGCC 1 cut(s) 34
ApeKI GCWGC 1 cut(s) 63
AspS9I GGNCC 2 cut(s) 35, 92
AvaII GGWCC 1 cut(s) 92
BbvI GCAGC 1 cut(s) 50
BccI CCATC 1 cut(s) 104
BisI GCNGC 1 cut(s) 64
BlsI GCNGC 1 cut(s) 65
Bme18I GGWCC 1 cut(s) 92
BmgT120I GGNCC 2 cut(s) 35, 92
BmiI GGNNCC 1 cut(s) 94
BsaJI CCNNGG 1 cut(s) 42
Bsc4I CCNNNNNNNGG 1 cut(s) 43
BseDI CCNNGG 1 cut(s) 42
BseLI CCNNNNNNNGG 1 cut(s) 43
BseXI GCAGC 1 cut(s) 50
BshFI GGCC 1 cut(s) 36
BslI CCNNNNNNNGG 1 cut(s) 43
BsnI GGCC 1 cut(s) 36
Bsp19I CCATGG 1 cut(s) 42
BspANI GGCC 1 cut(s) 36
BspLI GGNNCC 1 cut(s) 94
BspQI GCTCTTC 1 cut(s) 134
BssECI CCNNGG 1 cut(s) 42
BssT1I CCWWGG 1 cut(s) 42
Bst6I CTCTTC 2 cut(s) 32, 134
BstDSI CCRYGG 1 cut(s) 42
BstV1I GCAGC 1 cut(s) 50
BsuRI GGCC 1 cut(s) 36
BtgI CCRYGG 1 cut(s) 42
Cfr13I GGNCC 2 cut(s) 35, 92
CviAII CATG 1 cut(s) 43
CviJI RGCY 6 cut(s) 36, 56, 63, 74, 119, 127
CviKI_1 RGCY 6 cut(s) 36, 56, 63, 74, 119, 127
Eam1104I CTCTTC 2 cut(s) 32, 134
EarI CTCTTC 2 cut(s) 32, 134
Eco130I CCWWGG 1 cut(s) 42
Eco47I GGWCC 1 cut(s) 92
Eco57I CTGAAG 1 cut(s) 124
EcoT14I CCWWGG 1 cut(s) 42
ErhI CCWWGG 1 cut(s) 42
FaeI CATG 1 cut(s) 46
FaiI YATR 6 cut(s) 8, 13, 17, 19, 33, 44
FatI CATG 1 cut(s) 42
FauNDI CATATG 1 cut(s) 17
Fnu4HI GCNGC 1 cut(s) 64
Fsp4HI GCNGC 1 cut(s) 64
GluI GCNGC 1 cut(s) 64
HaeIII GGCC 1 cut(s) 36
Hin1II CATG 1 cut(s) 46
Hpy166II GTNNAC 1 cut(s) 92
Hpy188I TCNGA 1 cut(s) 115
Hpy8I GTNNAC 1 cut(s) 92
HpyCH4V TGCA 1 cut(s) 66
Hsp92II CATG 1 cut(s) 46
LguI GCTCTTC 1 cut(s) 134
LpnPI CCDG 2 cut(s) 127, 137
Lsp1109I GCAGC 1 cut(s) 50
MboII GAAGA 3 cut(s) 19, 121, 130
MluCI AATT 1 cut(s) 109
MnlI CCTC 1 cut(s) 109
MseI TTAA 1 cut(s) 148
NcoI CCATGG 1 cut(s) 42
NdeI CATATG 1 cut(s) 17
NlaIII CATG 1 cut(s) 46
NlaIV GGNNCC 1 cut(s) 94
PciSI GCTCTTC 1 cut(s) 134
PkrI GCNGC 1 cut(s) 65
PspN4I GGNNCC 1 cut(s) 94
PspPI GGNCC 2 cut(s) 35, 92
PsrI GAACNNNNNNTAC 1 cut(s) 28
SapI GCTCTTC 1 cut(s) 134
SaqAI TTAA 1 cut(s) 148
SatI GCNGC 1 cut(s) 64
Sau96I GGNCC 2 cut(s) 35, 92
SetI ASST 3 cut(s) 76, 129, 146
SgeI CNNG 4 cut(s) 49, 55, 69, 136
SinI GGWCC 1 cut(s) 92
Sse9I AATT 1 cut(s) 109
StyI CCWWGG 1 cut(s) 42
TasI AATT 1 cut(s) 109
Tru1I TTAA 1 cut(s) 148
Tru9I TTAA 1 cut(s) 148
TseI GCWGC 1 cut(s) 63
TspDTI ATGAA 2 cut(s) 17, 121
VpaK11BI GGWCC 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.