RchiOBHm_Chr3g0481611

Polygalacturonase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0014812
Physical Location & Seq
Reverse (-)
27672595 .. 27672971
377 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ44656

Sequence Viewer

Length: 297 bp
ATGAGAAAACTACTTGCAAGCTTTTTGATAGTTTGCATTTTTACTACATCGTCAAATTTTAATGTTGGGTATTGCCAAGAAACTTTTAATGTGCTTGACTACGGTGCTGTTGGAGATGGCCAAACCGATGATTCTGAAGCTTTCTTGAAAGCATGGAGTGATTTATGTGCAGCAAACGGAACACCAGCACTAGTAATACCAATGGAAAAAACATTCCTTTTGCAACCTACAAAATTCTCAGGTCCTTGCATATCCAATGGCTCTATATGTTACGGTAAGAAATTAACTAGCAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00040 ko01100 map00040 map01100
Pfam Domains
Protein Families
Glyco_hydro_28

Protein Analysis

98

Amino Acids

10.56

Weight (kDa)

5.09

Isoelectric Point (pI)

11.13

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pect-lyase_RHGA_epim PF12708 29 - 65 5e-06 Rhamnogalacturonase A/epimerase, pectate lyase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 118
AcsI RAATTY 2 cut(s) 55, 233
AcuI CTGAAG 1 cut(s) 156
AgsI TTSAA 1 cut(s) 148
AhlI ACTAGT 1 cut(s) 190
AluBI AGCT 3 cut(s) 21, 140, 294
AluI AGCT 3 cut(s) 21, 140, 294
AoxI GGCC 1 cut(s) 118
ApeKI GCWGC 2 cut(s) 170, 291
ApoI RAATTY 2 cut(s) 55, 233
AspS9I GGNCC 1 cut(s) 242
AvaII GGWCC 1 cut(s) 242
BalI TGGCCA 1 cut(s) 120
BbvI GCAGC 1 cut(s) 182
BccI CCATC 1 cut(s) 110
BcuI ACTAGT 1 cut(s) 190
BfaI CTAG 2 cut(s) 191, 288
BisI GCNGC 2 cut(s) 171, 292
BlsI GCNGC 2 cut(s) 172, 293
Bme18I GGWCC 1 cut(s) 242
BmgT120I GGNCC 1 cut(s) 242
BseMII CTCAG 1 cut(s) 252
BseXI GCAGC 1 cut(s) 182
BsgI GTGCAG 1 cut(s) 189
BshFI GGCC 1 cut(s) 120
BsnI GGCC 1 cut(s) 120
BspANI GGCC 1 cut(s) 120
BspCNI CTCAG 1 cut(s) 251
Bst4CI ACNGT 2 cut(s) 104, 275
BstC8I GCNNGC 1 cut(s) 19
BstDEI CTNAG 1 cut(s) 238
BstV1I GCAGC 1 cut(s) 182
BsuRI GGCC 1 cut(s) 120
Cac8I GCNNGC 1 cut(s) 19
Cfr13I GGNCC 1 cut(s) 242
CviAII CATG 1 cut(s) 153
CviJI RGCY 5 cut(s) 21, 120, 140, 261, 294
CviKI_1 RGCY 5 cut(s) 21, 120, 140, 261, 294
DdeI CTNAG 1 cut(s) 238
EaeI YGGCCR 1 cut(s) 118
Eco47I GGWCC 1 cut(s) 242
Eco57I CTGAAG 1 cut(s) 156
EcoO109I RGGNCCY 1 cut(s) 242
FaeI CATG 1 cut(s) 156
FaiI YATR 5 cut(s) 154, 166, 251, 266, 268
FatI CATG 1 cut(s) 152
Fnu4HI GCNGC 2 cut(s) 171, 292
Fsp4HI GCNGC 2 cut(s) 171, 292
FspBI CTAG 2 cut(s) 191, 288
GluI GCNGC 2 cut(s) 171, 292
HaeIII GGCC 1 cut(s) 120
Hin1II CATG 1 cut(s) 156
HindIII AAGCTT 2 cut(s) 19, 138
HinfI GANTC 1 cut(s) 131
Hpy188I TCNGA 1 cut(s) 136
Hpy188III TCNNGA 1 cut(s) 145
HpyCH4III ACNGT 2 cut(s) 104, 275
HpyCH4V TGCA 5 cut(s) 17, 36, 170, 223, 249
HpyF3I CTNAG 1 cut(s) 238
Hsp92II CATG 1 cut(s) 156
LpnPI CCDG 2 cut(s) 198, 225
Lsp1109I GCAGC 1 cut(s) 182
MaeI CTAG 2 cut(s) 191, 288
MaeIII GTNAC 1 cut(s) 269
MlsI TGGCCA 1 cut(s) 120
MluCI AATT 3 cut(s) 55, 233, 281
MluNI TGGCCA 1 cut(s) 120
MmeI TCCRAC 1 cut(s) 91
Mox20I TGGCCA 1 cut(s) 120
MscI TGGCCA 1 cut(s) 120
MseI TTAA 3 cut(s) 60, 87, 284
Msp20I TGGCCA 1 cut(s) 120
MspA1I CMGCKG 1 cut(s) 294
NlaIII CATG 1 cut(s) 156
PfeI GAWTC 1 cut(s) 131
PkrI GCNGC 2 cut(s) 172, 293
PpuMI RGGWCCY 1 cut(s) 242
Psp5II RGGWCCY 1 cut(s) 242
PspPI GGNCC 1 cut(s) 242
PspPPI RGGWCCY 1 cut(s) 242
PvuII CAGCTG 1 cut(s) 294
SaqAI TTAA 3 cut(s) 60, 87, 284
SatI GCNGC 2 cut(s) 171, 292
Sau96I GGNCC 1 cut(s) 242
SetI ASST 5 cut(s) 23, 142, 229, 244, 296
SinI GGWCC 1 cut(s) 242
SpeI ACTAGT 1 cut(s) 190
Sse9I AATT 3 cut(s) 55, 233, 281
SspMI CTAG 2 cut(s) 191, 288
TaaI ACNGT 2 cut(s) 104, 275
TasI AATT 3 cut(s) 55, 233, 281
TfiI GAWTC 1 cut(s) 131
Tru1I TTAA 3 cut(s) 60, 87, 284
Tru9I TTAA 3 cut(s) 60, 87, 284
TseI GCWGC 2 cut(s) 170, 291
TspGWI ACGGA 1 cut(s) 192
VpaK11BI GGWCC 1 cut(s) 242
XapI RAATTY 2 cut(s) 55, 233
XspI CTAG 2 cut(s) 191, 288
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.