Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000420.1

Orthogroup ID

OG0014812

Physical Location & Seq

Genomic Coordinates Forward (+)

143361 .. 144882

Gene Structure 1522 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000420.1_g000030.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 441 bp

atggcaaagcctaagcctctccaaattctggtaagtccaaattctggaaagtctcttcttttaagttacaagaatagattttgggtgttttctgatcagggtgtatttgttaacgttactgactatggcgctgttggaaatagtcttatagatgattctcagtgcatgagagacctttttggagctgtcaggaaggaacagaaagagatggtggcaagaattctcagaagcaaggggacaaactatctcttttggtcaccttcaggtggcctcataatacttgcaaggttgaatggttccaatgggaatttggaatttttcaatgtggatgagcttcggctctcgagtggaacccaaccgggagatatgttgctactcctactcttgggacttgtcatgagaagccgagttttaacaattggtcttttgatggccacctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03013 map03013

Pfam Domains

Protein Families

RRM_1 eIF2A

Protein Analysis

146

Amino Acids

16.13

Weight (kDa)

9.66

Isoelectric Point (pI)

30.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014812)

Species	Orthologous Gene IDs
malus_domestica	MD03G1260900.v1.1
pyrus_communis	pycom15g11180
rosa_chinensis	RchiOBHm_Chr2g0146311 RchiOBHm_Chr3g0481611
rosa_multiflora	Rmu_sc0010155.1_g000002 Rmu_ssc0000420.1_g000030
rosa_roxburghii	Rroxscaffold_153G00436760 Rroxscaffold_1G00032790 Rroxscaffold_2G00104840
rosa_rugosa	Rorug06G0113100
rosa_samantha	Rh2AG413400 Rh2DG433300 Rh4CG317800 Rh4DG260000 Rh4DG299500
rosa_wichuraiana	Rw4G022340 Rw4G025610

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	2 cut(s)	28, 44
AclI	AACGTT	1 cut(s)	114
AcoI	YGGCCR	1 cut(s)	432
AcsI	RAATTY	5 cut(s)	24, 40, 219, 307, 314
AcuI	CTGAAG	1 cut(s)	246
AfiI	CCNNNNNNNGG	4 cut(s)	28, 44, 266, 385
AgsI	TTSAA	2 cut(s)	292, 322
AluBI	AGCT	2 cut(s)	185, 334
AluI	AGCT	2 cut(s)	185, 334
Alw26I	GTCTC	2 cut(s)	57, 165
Ama87I	CYCGRG	1 cut(s)	343
AoxI	GGCC	2 cut(s)	268, 432
ApoI	RAATTY	5 cut(s)	24, 40, 219, 307, 314
AspLEI	GCGC	1 cut(s)	131
AsuC2I	CCSGG	1 cut(s)	360
AsuHPI	GGTGA	1 cut(s)	249
AvaI	CYCGRG	1 cut(s)	343
BalI	TGGCCA	1 cut(s)	434
BccI	CCATC	2 cut(s)	202, 424
BclI	TGATCA	1 cut(s)	94
BcnI	CCSGG	1 cut(s)	360
BcoDI	GTCTC	2 cut(s)	57, 165
BfaI	CTAG	1 cut(s)	439
BfoI	RGCGCY	1 cut(s)	132
Bme1390I	CCNGG	1 cut(s)	360
BmeT110I	CYCGRG	1 cut(s)	343
BmiI	GGNNCC	2 cut(s)	298, 352
BmrFI	CCNGG	1 cut(s)	360
Bpu10I	CCTNAGC	1 cut(s)	12
BpuMI	CCSGG	1 cut(s)	360
BsaI	GGTCTC	1 cut(s)	165
Bsc4I	CCNNNNNNNGG	4 cut(s)	28, 44, 266, 385
BseGI	GGATG	1 cut(s)	334
BseLI	CCNNNNNNNGG	4 cut(s)	28, 44, 266, 385
BseMII	CTCAG	2 cut(s)	173, 238
BshFI	GGCC	2 cut(s)	270, 434
BsiHKCI	CYCGRG	1 cut(s)	343
BsiSI	CCGG	1 cut(s)	359
BslFI	GGGAC	2 cut(s)	250, 402
BslI	CCNNNNNNNGG	4 cut(s)	28, 44, 266, 385
BsmAI	GTCTC	2 cut(s)	57, 165
BsmFI	GGGAC	2 cut(s)	250, 402
BsnI	GGCC	2 cut(s)	270, 434
Bso31I	GGTCTC	1 cut(s)	165
BsoBI	CYCGRG	1 cut(s)	343
Bsp143I	GATC	1 cut(s)	94
BspANI	GGCC	2 cut(s)	270, 434
BspCNI	CTCAG	2 cut(s)	172, 237
BspHI	TCATGA	1 cut(s)	396
BspLI	GGNNCC	2 cut(s)	298, 352
BspTNI	GGTCTC	1 cut(s)	165
BssMI	GATC	1 cut(s)	94
Bst6I	CTCTTC	1 cut(s)	60
BstDEI	CTNAG	3 cut(s)	12, 159, 224
BstEII	GGTNACC	1 cut(s)	255
BstF5I	GGATG	1 cut(s)	334
BstH2I	RGCGCY	1 cut(s)	132
BstHHI	GCGC	1 cut(s)	131
BstKTI	GATC	1 cut(s)	97
BstMAI	GTCTC	2 cut(s)	57, 165
BstMBI	GATC	1 cut(s)	94
BstPI	GGTNACC	1 cut(s)	255
BstSCI	CCNGG	1 cut(s)	358
BsuRI	GGCC	2 cut(s)	270, 434
BtsCI	GGATG	1 cut(s)	334
BtsIMutI	CAGTG	1 cut(s)	167
CciI	TCATGA	1 cut(s)	396
CfoI	GCGC	1 cut(s)	131
CviAII	CATG	2 cut(s)	166, 397
CviJI	RGCY	8 cut(s)	10, 16, 185, 270, 334, 340, 405, 434
CviKI_1	RGCY	8 cut(s)	10, 16, 185, 270, 334, 340, 405, 434
DdeI	CTNAG	3 cut(s)	12, 159, 224
DpnI	GATC	1 cut(s)	96
DpnII	GATC	1 cut(s)	94
EaeI	YGGCCR	1 cut(s)	432
Eam1104I	CTCTTC	1 cut(s)	60
EarI	CTCTTC	1 cut(s)	60
Eco31I	GGTCTC	1 cut(s)	165
Eco57I	CTGAAG	1 cut(s)	246
Eco88I	CYCGRG	1 cut(s)	343
Eco91I	GGTNACC	1 cut(s)	255
EcoO65I	GGTNACC	1 cut(s)	255
EcoRI	GAATTC	1 cut(s)	219
FaeI	CATG	2 cut(s)	169, 400
FaiI	YATR	6 cut(s)	126, 149, 167, 275, 368, 398
FaqI	GGGAC	2 cut(s)	250, 402
FatI	CATG	2 cut(s)	165, 396
FbaI	TGATCA	1 cut(s)	94
FokI	GGATG	1 cut(s)	341
FspBI	CTAG	1 cut(s)	439
GlaI	GCGC	1 cut(s)	130
HaeII	RGCGCY	1 cut(s)	132
HaeIII	GGCC	2 cut(s)	270, 434
HapII	CCGG	1 cut(s)	359
HhaI	GCGC	1 cut(s)	131
Hin1II	CATG	2 cut(s)	169, 400
Hin6I	GCGC	1 cut(s)	129
HinP1I	GCGC	1 cut(s)	129
HincII	GTYRAC	1 cut(s)	112
HindII	GTYRAC	1 cut(s)	112
HinfI	GANTC	1 cut(s)	155
HpaI	GTTAAC	1 cut(s)	112
HpaII	CCGG	1 cut(s)	359
HphI	GGTGA	1 cut(s)	249
Hpy166II	GTNNAC	1 cut(s)	112
Hpy188I	TCNGA	2 cut(s)	94, 227
Hpy188III	TCNNGA	4 cut(s)	45, 190, 343, 397
Hpy8I	GTNNAC	1 cut(s)	112
HpyAV	CCTTC	2 cut(s)	187, 270
HpyCH4IV	ACGT	1 cut(s)	114
HpyCH4V	TGCA	2 cut(s)	165, 284
HpyF3I	CTNAG	3 cut(s)	12, 159, 224
HpySE526I	ACGT	1 cut(s)	114
Hsp92II	CATG	2 cut(s)	169, 400
HspAI	GCGC	1 cut(s)	129
Ksp22I	TGATCA	1 cut(s)	94
KspAI	GTTAAC	1 cut(s)	112
Kzo9I	GATC	1 cut(s)	94
LmnI	GCTCC	1 cut(s)	182
LpnPI	CCDG	6 cut(s)	14, 30, 83, 175, 249, 372
MaeI	CTAG	1 cut(s)	439
MaeII	ACGT	1 cut(s)	114
MaeIII	GTNAC	3 cut(s)	65, 115, 255
MalI	GATC	1 cut(s)	96
MboI	GATC	1 cut(s)	94
MboII	GAAGA	1 cut(s)	47
MfeI	CAATTG	1 cut(s)	417
MlsI	TGGCCA	1 cut(s)	434
MluCI	AATT	6 cut(s)	24, 40, 219, 307, 314, 417
MluNI	TGGCCA	1 cut(s)	434
MmeI	TCCRAC	1 cut(s)	115
MnlI	CCTC	2 cut(s)	27, 281
Mox20I	TGGCCA	1 cut(s)	434
MscI	TGGCCA	1 cut(s)	434
MseI	TTAA	3 cut(s)	62, 111, 413
Msp20I	TGGCCA	1 cut(s)	434
MspI	CCGG	1 cut(s)	359
MspR9I	CCNGG	1 cut(s)	360
MunI	CAATTG	1 cut(s)	417
NciI	CCSGG	1 cut(s)	360
NdeII	GATC	1 cut(s)	94
NlaIII	CATG	2 cut(s)	169, 400
NlaIV	GGNNCC	2 cut(s)	298, 352
NmeAIII	GCCGAG	1 cut(s)	431
NmuCI	GTSAC	1 cut(s)	255
PaeR7I	CTCGAG	1 cut(s)	343
PagI	TCATGA	1 cut(s)	396
PfeI	GAWTC	1 cut(s)	155
PflMI	CCANNNNNTGG	2 cut(s)	28, 44
Psp1406I	AACGTT	1 cut(s)	114
PspEI	GGTNACC	1 cut(s)	255
PspN4I	GGNNCC	2 cut(s)	298, 352
SaqAI	TTAA	3 cut(s)	62, 111, 413
Sau3AI	GATC	1 cut(s)	94
ScrFI	CCNGG	1 cut(s)	360
SetI	ASST	8 cut(s)	117, 177, 187, 262, 268, 290, 336, 440
Sfr274I	CTCGAG	1 cut(s)	343
SlaI	CTCGAG	1 cut(s)	343
SmlI	CTYRAG	1 cut(s)	343
SmoI	CTYRAG	1 cut(s)	343
Sse9I	AATT	6 cut(s)	24, 40, 219, 307, 314, 417
SspMI	CTAG	1 cut(s)	439
StyD4I	CCNGG	1 cut(s)	358
TaiI	ACGT	1 cut(s)	117
TaqI	TCGA	1 cut(s)	344
TasI	AATT	6 cut(s)	24, 40, 219, 307, 314, 417
TfiI	GAWTC	1 cut(s)	155
Tru1I	TTAA	3 cut(s)	62, 111, 413
Tru9I	TTAA	3 cut(s)	62, 111, 413
TscAI	CASTG	1 cut(s)	167
TseFI	GTSAC	1 cut(s)	255
Tsp45I	GTSAC	1 cut(s)	255
TspRI	CASTG	1 cut(s)	167
Van91I	CCANNNNNTGG	2 cut(s)	28, 44
XapI	RAATTY	5 cut(s)	24, 40, 219, 307, 314
XcmI	CCANNNNNNNNNTGG	1 cut(s)	307
XhoI	CTCGAG	1 cut(s)	343
XspI	CTAG	1 cut(s)	439

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.