Rroxscaffold_153G00436760

Glycosyl hydrolases family 28

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000153
Physical Location & Seq
Forward (+)
332730 .. 334409
1680 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_153G00436760.1

Sequence Viewer

Length: 270 bp
ATGGGAGCTTTGACGGCAAAGCCTGAGCCTATGCGTTTGGAAGCCTCTCCAAATTCTGGTGTATTTGTTAACTTTATTGACTATGGCGCTGTTGGAAATGGTCTTATAGATGATTCTCAGGCCTTCGCAAAAGCATGGAGAGCCTCCTGCCTAGCTACTCAAGCTGTTCAAGCAAAGATCGTCATACCTGCTGCAAAAACTTTCCTATTGCAACCGACATATTTCAATGGTCCTTGCAATTCAAACTCCGTACATGTTGAGGTAACATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

89

Amino Acids

9.43

Weight (kDa)

6.52

Isoelectric Point (pI)

21.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 196
AccB7I CCANNNNNTGG 1 cut(s) 56
AcsI RAATTY 1 cut(s) 52
AfaI GTAC 1 cut(s) 252
AfiI CCNNNNNNNGG 1 cut(s) 56
AflIII ACRYGT 1 cut(s) 253
AgsI TTSAA 3 cut(s) 170, 226, 243
AluBI AGCT 3 cut(s) 8, 155, 164
AluI AGCT 3 cut(s) 8, 155, 164
AoxI GGCC 1 cut(s) 120
ApeKI GCWGC 1 cut(s) 191
ApoI RAATTY 1 cut(s) 52
AspLEI GCGC 1 cut(s) 89
AspS9I GGNCC 1 cut(s) 230
AvaII GGWCC 1 cut(s) 230
BbvI GCAGC 1 cut(s) 178
BceAI ACGGC 1 cut(s) 30
BfaI CTAG 1 cut(s) 152
BfoI RGCGCY 1 cut(s) 90
BfuAI ACCTGC 1 cut(s) 196
BisI GCNGC 1 cut(s) 192
BlsI GCNGC 1 cut(s) 193
Bme18I GGWCC 1 cut(s) 230
BmgT120I GGNCC 1 cut(s) 230
Bpu10I CCTNAGC 1 cut(s) 24
BpuEI CTTGAG 1 cut(s) 144
Bsc4I CCNNNNNNNGG 1 cut(s) 56
BseLI CCNNNNNNNGG 1 cut(s) 56
BseMII CTCAG 2 cut(s) 15, 131
BseXI GCAGC 1 cut(s) 178
BshFI GGCC 1 cut(s) 122
BslI CCNNNNNNNGG 1 cut(s) 56
BsnI GGCC 1 cut(s) 122
Bsp143I GATC 1 cut(s) 177
BspANI GGCC 1 cut(s) 122
BspCNI CTCAG 2 cut(s) 16, 130
BspMI ACCTGC 1 cut(s) 196
BssMI GATC 1 cut(s) 177
BstDEI CTNAG 2 cut(s) 24, 117
BstH2I RGCGCY 1 cut(s) 90
BstHHI GCGC 1 cut(s) 89
BstKTI GATC 1 cut(s) 180
BstMBI GATC 1 cut(s) 177
BstMWI GCNNNNNNNGC 4 cut(s) 14, 140, 161, 170
BstNSI RCATGY 1 cut(s) 257
BstV1I GCAGC 1 cut(s) 178
BsuRI GGCC 1 cut(s) 122
BveI ACCTGC 1 cut(s) 196
CfoI GCGC 1 cut(s) 89
Cfr13I GGNCC 1 cut(s) 230
Csp6I GTAC 1 cut(s) 251
CviAII CATG 2 cut(s) 135, 254
CviJI RGCY 8 cut(s) 8, 22, 28, 44, 122, 143, 155, 164
CviKI_1 RGCY 8 cut(s) 8, 22, 28, 44, 122, 143, 155, 164
CviQI GTAC 1 cut(s) 251
DdeI CTNAG 2 cut(s) 24, 117
DpnI GATC 1 cut(s) 179
DpnII GATC 1 cut(s) 177
Eco147I AGGCCT 1 cut(s) 122
Eco47I GGWCC 1 cut(s) 230
FaeI CATG 2 cut(s) 138, 257
FaiI YATR 8 cut(s) 32, 84, 107, 136, 185, 220, 255, 268
FatI CATG 2 cut(s) 134, 253
Fnu4HI GCNGC 1 cut(s) 192
Fsp4HI GCNGC 1 cut(s) 192
FspBI CTAG 1 cut(s) 152
GlaI GCGC 1 cut(s) 88
GluI GCNGC 1 cut(s) 192
HaeII RGCGCY 1 cut(s) 90
HaeIII GGCC 1 cut(s) 122
HhaI GCGC 1 cut(s) 89
Hin1II CATG 2 cut(s) 138, 257
Hin6I GCGC 1 cut(s) 87
HinP1I GCGC 1 cut(s) 87
HincII GTYRAC 1 cut(s) 70
HindII GTYRAC 1 cut(s) 70
HinfI GANTC 1 cut(s) 113
HpaI GTTAAC 1 cut(s) 70
Hpy166II GTNNAC 1 cut(s) 70
Hpy8I GTNNAC 1 cut(s) 70
HpyAV CCTTC 1 cut(s) 133
HpyCH4V TGCA 3 cut(s) 194, 211, 237
HpyF10VI GCNNNNNNNGC 4 cut(s) 14, 140, 161, 170
HpyF3I CTNAG 2 cut(s) 24, 117
Hsp92II CATG 2 cut(s) 138, 257
HspAI GCGC 1 cut(s) 87
KspAI GTTAAC 1 cut(s) 70
Kzo9I GATC 1 cut(s) 177
LmnI GCTCC 1 cut(s) 5
LpnPI CCDG 5 cut(s) 36, 42, 104, 160, 201
Lsp1109I GCAGC 1 cut(s) 178
MaeI CTAG 1 cut(s) 152
MaeIII GTNAC 1 cut(s) 262
MalI GATC 1 cut(s) 179
MboI GATC 1 cut(s) 177
MluCI AATT 2 cut(s) 52, 238
MmeI TCCRAC 1 cut(s) 73
MnlI CCTC 3 cut(s) 55, 154, 253
MseI TTAA 1 cut(s) 69
MwoI GCNNNNNNNGC 4 cut(s) 14, 140, 161, 170
NdeII GATC 1 cut(s) 177
NlaIII CATG 2 cut(s) 138, 257
NspI RCATGY 1 cut(s) 257
PceI AGGCCT 1 cut(s) 122
PciI ACATGT 1 cut(s) 253
PfeI GAWTC 1 cut(s) 113
PflMI CCANNNNNTGG 1 cut(s) 56
PkrI GCNGC 1 cut(s) 193
PscI ACATGT 1 cut(s) 253
PspPI GGNCC 1 cut(s) 230
RsaI GTAC 1 cut(s) 252
RsaNI GTAC 1 cut(s) 251
SaqAI TTAA 1 cut(s) 69
SatI GCNGC 1 cut(s) 192
Sau3AI GATC 1 cut(s) 177
Sau96I GGNCC 1 cut(s) 230
SetI ASST 5 cut(s) 10, 157, 166, 190, 264
SinI GGWCC 1 cut(s) 230
SmlI CTYRAG 1 cut(s) 159
SmoI CTYRAG 1 cut(s) 159
Sse9I AATT 2 cut(s) 52, 238
SseBI AGGCCT 1 cut(s) 122
SspMI CTAG 1 cut(s) 152
StuI AGGCCT 1 cut(s) 122
TasI AATT 2 cut(s) 52, 238
TfiI GAWTC 1 cut(s) 113
Tru1I TTAA 1 cut(s) 69
Tru9I TTAA 1 cut(s) 69
TseI GCWGC 1 cut(s) 191
TspGWI ACGGA 1 cut(s) 238
Van91I CCANNNNNTGG 1 cut(s) 56
VpaK11BI GGWCC 1 cut(s) 230
XapI RAATTY 1 cut(s) 52
XceI RCATGY 1 cut(s) 257
XspI CTAG 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.