Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0010155.1

Orthogroup ID

OG0014812

Physical Location & Seq

Genomic Coordinates Reverse (-)

5656 .. 6918

Gene Structure 1263 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0010155.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 390 bp

atgacgataacgaaacagagacaaccaaaatggaaaatcggcgaccggccaaaacaaaggtgggcaacgtcgagggacgccgctaatcacaagtcaaagatgggagctttgatggaaaagcctgagcctctccaaattctgaagaacgagaatttaggcaattggggagtggagatatggaatcacttggcatggatttgcaaaggtgtatctgttaacgttactgactatggcactgttggaaatagtcttatagatgattctcaggctttcgcaaaagcatggagagcctcctgcctggctactcaagctgatcaagcaaacatcgtcatgcctgttgcaaaaactttcatgttgcaaccgacagatttcaaactccgtacatgttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00040 ko01100 map00040 map01100

Pfam Domains

Protein Families

Glyco_hydro_28

Protein Analysis

129

Amino Acids

14.56

Weight (kDa)

9.58

Isoelectric Point (pI)

44.4

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014812)

Species	Orthologous Gene IDs
malus_domestica	MD03G1260900.v1.1
pyrus_communis	pycom15g11180
rosa_chinensis	RchiOBHm_Chr2g0146311 RchiOBHm_Chr3g0481611
rosa_multiflora	Rmu_sc0010155.1_g000002 Rmu_ssc0000420.1_g000030
rosa_roxburghii	Rroxscaffold_153G00436760 Rroxscaffold_1G00032790 Rroxscaffold_2G00104840
rosa_rugosa	Rorug06G0113100
rosa_samantha	Rh2AG413400 Rh2DG433300 Rh4CG317800 Rh4DG260000 Rh4DG299500
rosa_wichuraiana	Rw4G022340 Rw4G025610

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	81
AclI	AACGTT	1 cut(s)	219
AcoI	YGGCCR	1 cut(s)	47
AcsI	RAATTY	2 cut(s)	135, 151
AcuI	CTGAAG	1 cut(s)	161
AcyI	GRCGYC	1 cut(s)	78
AfaI	GTAC	1 cut(s)	382
AflIII	ACRYGT	1 cut(s)	383
AgsI	TTSAA	1 cut(s)	373
AjnI	CCWGG	1 cut(s)	297
AluBI	AGCT	2 cut(s)	107, 311
AluI	AGCT	2 cut(s)	107, 311
Alw26I	GTCTC	1 cut(s)	13
AoxI	GGCC	1 cut(s)	47
ApoI	RAATTY	2 cut(s)	135, 151
BccI	CCATC	2 cut(s)	94, 106
BciT130I	CCWGG	1 cut(s)	299
BclI	TGATCA	1 cut(s)	313
BcoDI	GTCTC	1 cut(s)	13
BisI	GCNGC	1 cut(s)	81
BlsI	GCNGC	1 cut(s)	82
Bme1390I	CCNGG	1 cut(s)	299
BmrFI	CCNGG	1 cut(s)	299
Bpu10I	CCTNAGC	1 cut(s)	123
BpuEI	CTTGAG	1 cut(s)	291
BsaHI	GRCGYC	1 cut(s)	78
Bse118I	RCCGGY	1 cut(s)	45
BseBI	CCWGG	1 cut(s)	299
BseMII	CTCAG	2 cut(s)	114, 278
Bsh1285I	CGRYCG	1 cut(s)	46
BshFI	GGCC	1 cut(s)	49
BsiEI	CGRYCG	1 cut(s)	46
BsiSI	CCGG	1 cut(s)	46
BslFI	GGGAC	1 cut(s)	89
BsmAI	GTCTC	1 cut(s)	13
BsmFI	GGGAC	1 cut(s)	89
BsnI	GGCC	1 cut(s)	49
Bsp143I	GATC	1 cut(s)	313
BspACI	CCGC	1 cut(s)	81
BspANI	GGCC	1 cut(s)	49
BspCNI	CTCAG	2 cut(s)	115, 277
BsrFI	RCCGGY	1 cut(s)	45
BssAI	RCCGGY	1 cut(s)	45
BssMI	GATC	1 cut(s)	313
BssNI	GRCGYC	1 cut(s)	78
Bst2UI	CCWGG	1 cut(s)	299
Bst4CI	ACNGT	1 cut(s)	238
BstACI	GRCGYC	1 cut(s)	78
BstDEI	CTNAG	2 cut(s)	123, 264
BstKTI	GATC	1 cut(s)	316
BstMAI	GTCTC	1 cut(s)	13
BstMBI	GATC	1 cut(s)	313
BstMCI	CGRYCG	1 cut(s)	46
BstMWI	GCNNNNNNNGC	3 cut(s)	287, 308, 317
BstNI	CCWGG	1 cut(s)	299
BstNSI	RCATGY	1 cut(s)	387
BstSCI	CCNGG	1 cut(s)	297
BsuRI	GGCC	1 cut(s)	49
BtsIMutI	CAGTG	1 cut(s)	234
Cfr10I	RCCGGY	1 cut(s)	45
CseI	GACGC	1 cut(s)	86
Csp6I	GTAC	1 cut(s)	381
CviAII	CATG	5 cut(s)	192, 282, 331, 352, 384
CviJI	RGCY	8 cut(s)	49, 107, 121, 127, 269, 290, 302, 311
CviKI_1	RGCY	8 cut(s)	49, 107, 121, 127, 269, 290, 302, 311
CviQI	GTAC	1 cut(s)	381
DdeI	CTNAG	2 cut(s)	123, 264
DpnI	GATC	1 cut(s)	315
DpnII	GATC	1 cut(s)	313
EaeI	YGGCCR	1 cut(s)	47
Eco57I	CTGAAG	1 cut(s)	161
EcoRII	CCWGG	1 cut(s)	297
FaeI	CATG	5 cut(s)	195, 285, 334, 355, 387
FaiI	YATR	8 cut(s)	178, 193, 231, 254, 283, 332, 353, 385
FaqI	GGGAC	1 cut(s)	89
FatI	CATG	5 cut(s)	191, 281, 330, 351, 383
FbaI	TGATCA	1 cut(s)	313
Fnu4HI	GCNGC	1 cut(s)	81
Fsp4HI	GCNGC	1 cut(s)	81
GluI	GCNGC	1 cut(s)	81
HaeIII	GGCC	1 cut(s)	49
HapII	CCGG	1 cut(s)	46
HgaI	GACGC	1 cut(s)	86
Hin1I	GRCGYC	1 cut(s)	78
Hin1II	CATG	5 cut(s)	195, 285, 334, 355, 387
HincII	GTYRAC	1 cut(s)	217
HindII	GTYRAC	1 cut(s)	217
HinfI	GANTC	2 cut(s)	181, 260
HpaI	GTTAAC	1 cut(s)	217
HpaII	CCGG	1 cut(s)	46
Hpy166II	GTNNAC	1 cut(s)	217
Hpy188I	TCNGA	1 cut(s)	141
Hpy8I	GTNNAC	1 cut(s)	217
Hpy99I	CGWCG	1 cut(s)	73
HpyCH4III	ACNGT	1 cut(s)	238
HpyCH4IV	ACGT	2 cut(s)	68, 219
HpyCH4V	TGCA	3 cut(s)	201, 341, 358
HpyF10VI	GCNNNNNNNGC	3 cut(s)	287, 308, 317
HpyF3I	CTNAG	2 cut(s)	123, 264
HpySE526I	ACGT	2 cut(s)	68, 219
Hsp92I	GRCGYC	1 cut(s)	78
Hsp92II	CATG	5 cut(s)	195, 285, 334, 355, 387
Ksp22I	TGATCA	1 cut(s)	313
KspAI	GTTAAC	1 cut(s)	217
Kzo9I	GATC	1 cut(s)	313
LmnI	GCTCC	1 cut(s)	104
LpnPI	CCDG	7 cut(s)	59, 135, 251, 284, 307, 311, 348
MaeII	ACGT	2 cut(s)	68, 219
MaeIII	GTNAC	1 cut(s)	220
MalI	GATC	1 cut(s)	315
MboI	GATC	1 cut(s)	313
MboII	GAAGA	1 cut(s)	154
MfeI	CAATTG	1 cut(s)	160
MluCI	AATT	3 cut(s)	135, 151, 160
MmeI	TCCRAC	1 cut(s)	220
MnlI	CCTC	3 cut(s)	66, 138, 301
MseI	TTAA	1 cut(s)	216
MslI	CAYNNNNRTG	1 cut(s)	329
MspI	CCGG	1 cut(s)	46
MspR9I	CCNGG	1 cut(s)	299
MunI	CAATTG	1 cut(s)	160
MvaI	CCWGG	1 cut(s)	299
MwoI	GCNNNNNNNGC	3 cut(s)	287, 308, 317
NdeII	GATC	1 cut(s)	313
NlaIII	CATG	5 cut(s)	195, 285, 334, 355, 387
NspI	RCATGY	1 cut(s)	387
PciI	ACATGT	1 cut(s)	383
PfeI	GAWTC	2 cut(s)	181, 260
PkrI	GCNGC	1 cut(s)	82
PscI	ACATGT	1 cut(s)	383
Psp1406I	AACGTT	1 cut(s)	219
Psp6I	CCWGG	1 cut(s)	297
PspGI	CCWGG	1 cut(s)	297
RsaI	GTAC	1 cut(s)	382
RsaNI	GTAC	1 cut(s)	381
RseI	CAYNNNNRTG	1 cut(s)	329
SaqAI	TTAA	1 cut(s)	216
SatI	GCNGC	1 cut(s)	81
Sau3AI	GATC	1 cut(s)	313
ScrFI	CCNGG	1 cut(s)	299
SetI	ASST	6 cut(s)	62, 71, 109, 208, 222, 313
SmiMI	CAYNNNNRTG	1 cut(s)	329
SmlI	CTYRAG	1 cut(s)	306
SmoI	CTYRAG	1 cut(s)	306
Sse9I	AATT	3 cut(s)	135, 151, 160
SsiI	CCGC	1 cut(s)	81
StyD4I	CCNGG	1 cut(s)	297
TaaI	ACNGT	1 cut(s)	238
TaiI	ACGT	2 cut(s)	71, 222
TaqI	TCGA	1 cut(s)	71
TasI	AATT	3 cut(s)	135, 151, 160
TauI	GCSGC	1 cut(s)	83
TfiI	GAWTC	2 cut(s)	181, 260
Tru1I	TTAA	1 cut(s)	216
Tru9I	TTAA	1 cut(s)	216
TscAI	CASTG	1 cut(s)	241
TspDTI	ATGAA	1 cut(s)	340
TspGWI	ACGGA	1 cut(s)	368
TspRI	CASTG	1 cut(s)	241
XapI	RAATTY	2 cut(s)	135, 151
XceI	RCATGY	1 cut(s)	387
XcmI	CCANNNNNNNNNTGG	1 cut(s)	57

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.