RchiOBHm_Chr5g0035021

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
28956709 .. 28959848
3140 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31396

Sequence Viewer

Length: 150 bp
ATGGAATTGTTGGCTGTGGCATATTCGTCCCTTGTAGCCAAAATGGAGGAGATTATATATAGGTTGGTCATGCTGGAATTTTCAACCACACAGAAGTATTCTCTTGCATCTAATTCAACTTGCAATGTGGAAGAGGCTGGTGATCTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.46

Weight (kDa)

4.31

Isoelectric Point (pI)

32.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 77
AgsI TTSAA 2 cut(s) 84, 117
ApoI RAATTY 1 cut(s) 77
BfmI CTRYAG 1 cut(s) 146
BmsI GCATC 1 cut(s) 116
Bse3DI GCAATG 1 cut(s) 130
BseMI GCAATG 1 cut(s) 130
BseRI GAGGAG 1 cut(s) 62
BslFI GGGAC 1 cut(s) 13
BsmFI GGGAC 1 cut(s) 13
Bsp143I GATC 1 cut(s) 142
BsrDI GCAATG 1 cut(s) 130
BssMI GATC 1 cut(s) 142
Bst6I CTCTTC 1 cut(s) 126
BstKTI GATC 1 cut(s) 145
BstMBI GATC 1 cut(s) 142
BstSFI CTRYAG 1 cut(s) 146
CviAII CATG 1 cut(s) 70
CviJI RGCY 3 cut(s) 14, 38, 137
CviKI_1 RGCY 3 cut(s) 14, 38, 137
DpnI GATC 1 cut(s) 144
DpnII GATC 1 cut(s) 142
Eam1104I CTCTTC 1 cut(s) 126
EarI CTCTTC 1 cut(s) 126
FaeI CATG 1 cut(s) 73
FaiI YATR 5 cut(s) 22, 56, 58, 60, 71
FaqI GGGAC 1 cut(s) 13
FatI CATG 1 cut(s) 69
Hin1II CATG 1 cut(s) 73
HpyCH4V TGCA 2 cut(s) 107, 123
Hsp92II CATG 1 cut(s) 73
Kzo9I GATC 1 cut(s) 142
LpnPI CCDG 2 cut(s) 59, 123
LweI GCATC 1 cut(s) 116
MalI GATC 1 cut(s) 144
MboI GATC 1 cut(s) 142
MboII GAAGA 1 cut(s) 143
MluCI AATT 3 cut(s) 5, 77, 112
MnlI CCTC 2 cut(s) 40, 127
NdeII GATC 1 cut(s) 142
NlaIII CATG 1 cut(s) 73
Sau3AI GATC 1 cut(s) 142
SetI ASST 1 cut(s) 65
SfaNI GCATC 1 cut(s) 116
SfcI CTRYAG 1 cut(s) 146
SgeI CNNG 5 cut(s) 44, 82, 86, 116, 132
Sse9I AATT 3 cut(s) 5, 77, 112
TasI AATT 3 cut(s) 5, 77, 112
XapI RAATTY 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.