Rroxscaffold_2G00130530

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
66737903 .. 66739337
1435 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00130530.1

Sequence Viewer

Length: 153 bp
ATGGAATTGTTGGCTGTGGCATATTCGTCCCTTGTAGCCAAAATGGAGGAGATTATATATAGGTTGGTCATGCTGGAATTTTCAGCCAGCCACACGAAGTATTCTCTTGCATCTAATTCAACTTACAATGTGGAAGAGGCTGGTGATCCGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.57

Weight (kDa)

4.54

Isoelectric Point (pI)

32.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 140
AcsI RAATTY 1 cut(s) 77
AgsI TTSAA 1 cut(s) 120
AlwI GGATC 1 cut(s) 140
ApoI RAATTY 1 cut(s) 77
BmsI GCATC 1 cut(s) 119
BseRI GAGGAG 1 cut(s) 62
BslFI GGGAC 1 cut(s) 13
BsmFI GGGAC 1 cut(s) 13
Bsp143I GATC 1 cut(s) 145
BspPI GGATC 1 cut(s) 140
BssMI GATC 1 cut(s) 145
Bst6I CTCTTC 1 cut(s) 129
BstC8I GCNNGC 1 cut(s) 88
BstKTI GATC 1 cut(s) 148
BstMBI GATC 1 cut(s) 145
Cac8I GCNNGC 1 cut(s) 88
CviAII CATG 1 cut(s) 70
CviJI RGCY 5 cut(s) 14, 38, 86, 90, 140
CviKI_1 RGCY 5 cut(s) 14, 38, 86, 90, 140
DpnI GATC 1 cut(s) 147
DpnII GATC 1 cut(s) 145
Eam1104I CTCTTC 1 cut(s) 129
EarI CTCTTC 1 cut(s) 129
FaeI CATG 1 cut(s) 73
FaiI YATR 5 cut(s) 22, 56, 58, 60, 71
FaqI GGGAC 1 cut(s) 13
FatI CATG 1 cut(s) 69
Hin1II CATG 1 cut(s) 73
HpyCH4V TGCA 1 cut(s) 110
Hsp92II CATG 1 cut(s) 73
Kzo9I GATC 1 cut(s) 145
LpnPI CCDG 3 cut(s) 59, 100, 126
LweI GCATC 1 cut(s) 119
MalI GATC 1 cut(s) 147
MboI GATC 1 cut(s) 145
MboII GAAGA 1 cut(s) 146
MluCI AATT 3 cut(s) 5, 77, 115
MnlI CCTC 2 cut(s) 40, 130
NdeII GATC 1 cut(s) 145
NlaIII CATG 1 cut(s) 73
Sau3AI GATC 1 cut(s) 145
SetI ASST 1 cut(s) 65
SfaNI GCATC 1 cut(s) 119
SgeI CNNG 6 cut(s) 44, 82, 86, 99, 106, 119
Sse9I AATT 3 cut(s) 5, 77, 115
TasI AATT 3 cut(s) 5, 77, 115
TspGWI ACGGA 1 cut(s) 138
XapI RAATTY 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.